ID: 1053019235

View in Genome Browser
Species Human (GRCh38)
Location 9:34683503-34683525
Sequence AGTTCTATCCTGCACCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053019225_1053019235 20 Left 1053019225 9:34683460-34683482 CCATCACCAGCCCTCCACTTGTC No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019229_1053019235 6 Left 1053019229 9:34683474-34683496 CCACTTGTCCCTCTCCTCTTCCT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019228_1053019235 9 Left 1053019228 9:34683471-34683493 CCTCCACTTGTCCCTCTCCTCTT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019226_1053019235 14 Left 1053019226 9:34683466-34683488 CCAGCCCTCCACTTGTCCCTCTC No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019230_1053019235 -2 Left 1053019230 9:34683482-34683504 CCCTCTCCTCTTCCTATCCACAG No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019232_1053019235 -8 Left 1053019232 9:34683488-34683510 CCTCTTCCTATCCACAGTTCTAT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019227_1053019235 10 Left 1053019227 9:34683470-34683492 CCCTCCACTTGTCCCTCTCCTCT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019231_1053019235 -3 Left 1053019231 9:34683483-34683505 CCTCTCCTCTTCCTATCCACAGT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data
1053019224_1053019235 21 Left 1053019224 9:34683459-34683481 CCCATCACCAGCCCTCCACTTGT No data
Right 1053019235 9:34683503-34683525 AGTTCTATCCTGCACCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053019235 Original CRISPR AGTTCTATCCTGCACCATGA AGG Intergenic
No off target data available for this crispr