ID: 1053019239

View in Genome Browser
Species Human (GRCh38)
Location 9:34683518-34683540
Sequence CATGAAGGGTCTCACGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053019233_1053019239 1 Left 1053019233 9:34683494-34683516 CCTATCCACAGTTCTATCCTGCA No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019228_1053019239 24 Left 1053019228 9:34683471-34683493 CCTCCACTTGTCCCTCTCCTCTT No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019230_1053019239 13 Left 1053019230 9:34683482-34683504 CCCTCTCCTCTTCCTATCCACAG No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019226_1053019239 29 Left 1053019226 9:34683466-34683488 CCAGCCCTCCACTTGTCCCTCTC No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019232_1053019239 7 Left 1053019232 9:34683488-34683510 CCTCTTCCTATCCACAGTTCTAT No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019227_1053019239 25 Left 1053019227 9:34683470-34683492 CCCTCCACTTGTCCCTCTCCTCT No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019234_1053019239 -4 Left 1053019234 9:34683499-34683521 CCACAGTTCTATCCTGCACCATG No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019231_1053019239 12 Left 1053019231 9:34683483-34683505 CCTCTCCTCTTCCTATCCACAGT No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data
1053019229_1053019239 21 Left 1053019229 9:34683474-34683496 CCACTTGTCCCTCTCCTCTTCCT No data
Right 1053019239 9:34683518-34683540 CATGAAGGGTCTCACGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053019239 Original CRISPR CATGAAGGGTCTCACGTGTC TGG Intergenic
No off target data available for this crispr