ID: 1053020658

View in Genome Browser
Species Human (GRCh38)
Location 9:34691707-34691729
Sequence GAGGCCACCCCAGGATCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053020658_1053020663 9 Left 1053020658 9:34691707-34691729 CCATGAGATCCTGGGGTGGCCTC No data
Right 1053020663 9:34691739-34691761 CACTGTGCCTGCCCACTATGTGG No data
1053020658_1053020664 10 Left 1053020658 9:34691707-34691729 CCATGAGATCCTGGGGTGGCCTC No data
Right 1053020664 9:34691740-34691762 ACTGTGCCTGCCCACTATGTGGG No data
1053020658_1053020668 28 Left 1053020658 9:34691707-34691729 CCATGAGATCCTGGGGTGGCCTC No data
Right 1053020668 9:34691758-34691780 GTGGGAACCAGTCCTTCCCTTGG No data
1053020658_1053020670 30 Left 1053020658 9:34691707-34691729 CCATGAGATCCTGGGGTGGCCTC No data
Right 1053020670 9:34691760-34691782 GGGAACCAGTCCTTCCCTTGGGG No data
1053020658_1053020669 29 Left 1053020658 9:34691707-34691729 CCATGAGATCCTGGGGTGGCCTC No data
Right 1053020669 9:34691759-34691781 TGGGAACCAGTCCTTCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053020658 Original CRISPR GAGGCCACCCCAGGATCTCA TGG (reversed) Intergenic
No off target data available for this crispr