ID: 1053023115

View in Genome Browser
Species Human (GRCh38)
Location 9:34709313-34709335
Sequence GAACCCAAGATGCAAGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 191}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053023115_1053023126 23 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023126 9:34709359-34709381 GGTGGGGTCTCCAGGGCTCCAGG 0: 1
1: 0
2: 6
3: 41
4: 467
1053023115_1053023118 -7 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023118 9:34709329-34709351 TGGGTTCAGGCTTCAAGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
1053023115_1053023120 2 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023120 9:34709338-34709360 GCTTCAAGCGCTGGTGAGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 116
1053023115_1053023125 16 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023125 9:34709352-34709374 TGAGGCTGGTGGGGTCTCCAGGG 0: 1
1: 0
2: 5
3: 35
4: 335
1053023115_1053023124 15 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023124 9:34709351-34709373 GTGAGGCTGGTGGGGTCTCCAGG 0: 1
1: 0
2: 2
3: 35
4: 379
1053023115_1053023119 -2 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023119 9:34709334-34709356 TCAGGCTTCAAGCGCTGGTGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
1053023115_1053023121 5 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023121 9:34709341-34709363 TCAAGCGCTGGTGAGGCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 253
1053023115_1053023123 7 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023123 9:34709343-34709365 AAGCGCTGGTGAGGCTGGTGGGG 0: 1
1: 0
2: 2
3: 27
4: 266
1053023115_1053023122 6 Left 1053023115 9:34709313-34709335 CCTCCTTCTTGCATCTTGGGTTC 0: 1
1: 0
2: 3
3: 14
4: 191
Right 1053023122 9:34709342-34709364 CAAGCGCTGGTGAGGCTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053023115 Original CRISPR GAACCCAAGATGCAAGAAGG AGG (reversed) Exonic
900508063 1:3039446-3039468 GAACCCAGGAAATAAGAAGGGGG - Intergenic
902448711 1:16483801-16483823 GGAACCAGGATGCAAGGAGGAGG - Intergenic
902503044 1:16923109-16923131 GAACCCAAGATACAGGAAGAGGG + Intronic
902561816 1:17282358-17282380 GAAGCCAAGCTGGAAGAAGAGGG - Intronic
904771294 1:32882721-32882743 GGACCAAAGAGGCAACAAGGTGG + Intergenic
905644819 1:39617673-39617695 GAACCCCAGATGCATGGAGCTGG - Intergenic
907240115 1:53076541-53076563 GGACCCAACATACTAGAAGGAGG - Intronic
907411853 1:54288729-54288751 GAACCCAAGATAAAAGGTGGAGG - Intronic
908034975 1:60042049-60042071 GACCTCAAGAAGGAAGAAGGAGG - Intronic
909467886 1:75994025-75994047 AAATCCAAGATTCAAGAAGAGGG - Intergenic
911484787 1:98492034-98492056 GAACAAAAGATGCAACAAAGAGG + Intergenic
912561737 1:110555963-110555985 GAACCCAAGAGGCAGGGAGGTGG - Intergenic
914996095 1:152544436-152544458 GGACCCAAGAAGCATGAAGGGGG + Intronic
915444539 1:155967197-155967219 GAGCTCAAGAAGCACGAAGGTGG + Intronic
916027028 1:160841912-160841934 GAACCCAAGCTGAAAGTAGCGGG + Intronic
916124519 1:161557405-161557427 GAACCCAAGATGCAGGTGGTGGG - Intergenic
916134409 1:161638755-161638777 GAACCCAAGATGCAGGTGGTGGG - Intronic
917114101 1:171584607-171584629 TGAACCAAGATGCAAGATGGAGG + Intronic
918153126 1:181816006-181816028 GAACTCAATATGAAAGAATGAGG + Intergenic
918805135 1:189031051-189031073 AAACCCCAGTTGCAAGAAGCTGG + Intergenic
919850009 1:201666225-201666247 GGAGCCAAGAAGCAAGAGGGAGG - Intronic
920133811 1:203753578-203753600 GAACCCCAGAAGGAACAAGGAGG + Intergenic
1064416028 10:15150959-15150981 CAACCCAATATGTAAGAAGAGGG - Intronic
1064925384 10:20563640-20563662 GGAACTAAGATGAAAGAAGGAGG - Intergenic
1066495970 10:35942510-35942532 GACCCCAAAATGAAAGAAGGAGG - Intergenic
1069702907 10:70439649-70439671 AAACCCAAGATGGAAGGAGTGGG + Intronic
1072295395 10:94004583-94004605 GAGCCCAAGATGTAAGAAGGTGG + Intronic
1073502954 10:103958313-103958335 GGATCCAAGATGCAAGAGGAAGG + Intergenic
1075423594 10:122324818-122324840 GAAGCCAAGAAGCAACATGGCGG - Intronic
1076429918 10:130394624-130394646 GGACACAAGATGCCAGAAGTAGG + Intergenic
1079017447 11:16881329-16881351 GAACCTAAGATTTAATAAGGTGG - Intronic
1079156783 11:17955434-17955456 GAACTCAAAAGTCAAGAAGGAGG + Intronic
1083732966 11:64663001-64663023 GAACCCAAGAGGGAAGAACTGGG + Intronic
1083921280 11:65782315-65782337 AAACCCAAGATGAAAGAGGCAGG + Intergenic
1084509370 11:69593646-69593668 GGACCCCAGCAGCAAGAAGGTGG - Intergenic
1085131296 11:74041269-74041291 GAGCATAAGATGCAAGAAGCAGG - Intronic
1088990458 11:114949071-114949093 CCAACAAAGATGCAAGAAGGAGG + Intergenic
1089187317 11:116628111-116628133 GATCCCAAGATGAAATCAGGTGG - Intergenic
1090786025 11:130048393-130048415 GAACCCAAAGTAAAAGAAGGAGG - Intergenic
1098470905 12:70842623-70842645 GAAGACAAGACACAAGAAGGAGG - Intronic
1102540255 12:113613755-113613777 GACCCCAAGAAGCAAGAAGGAGG - Intergenic
1104162290 12:126191934-126191956 GCACCCAAGATCCAGGAAGTGGG + Intergenic
1104180324 12:126373470-126373492 GAAGCCAGGAAGCCAGAAGGGGG + Intergenic
1106796827 13:33215270-33215292 GAGCCCAAGCTGCAAGGATGGGG - Intronic
1106815963 13:33407447-33407469 AAACCCAAAATGCAAAAAGCAGG - Intergenic
1107408540 13:40137735-40137757 GAACTCCAGATGCAGGTAGGAGG - Intergenic
1107502808 13:40997848-40997870 GAACCCAAAAAACAAGAAGCAGG + Intronic
1108112294 13:47088129-47088151 GAACCCAAGATCAAACAGGGTGG - Intergenic
1109421530 13:62118305-62118327 GAACCCAGGAGGCAAGAGGTTGG - Intergenic
1109458540 13:62625454-62625476 GAACCCAAGTGCCAAGAGGGCGG - Intergenic
1110453207 13:75660485-75660507 AAAACCAAGAAACAAGAAGGAGG - Intronic
1111858665 13:93673143-93673165 CAACCCAACAGGCAAGAAGGAGG + Intronic
1112917509 13:104569638-104569660 GAACCCAAGCTGCAAATATGGGG - Intergenic
1116690918 14:48104360-48104382 GGACCCTAGAAGCAAGATGGAGG + Intergenic
1119932584 14:78562584-78562606 TAACCCATGAGGCAAGAAAGAGG + Intronic
1120776150 14:88440037-88440059 GAACCCAAGAAGCAACTAGAGGG - Intronic
1122694893 14:103547699-103547721 GAAACCAGGATGCAAGAGGAAGG + Intergenic
1123912694 15:24984124-24984146 GTGCCCAAGAATCAAGAAGGAGG + Intergenic
1125575629 15:40753786-40753808 GAAACCAAGATTCAAAAAGATGG - Intronic
1126795244 15:52255206-52255228 GAACCCAAGGTCCCAGAGGGAGG + Intronic
1133541455 16:6759036-6759058 GAACCTTAAATGCAAGAAAGAGG - Intronic
1135954994 16:26949041-26949063 GTATCCAAGAGGTAAGAAGGTGG - Intergenic
1138463746 16:57171312-57171334 GGCTTCAAGATGCAAGAAGGAGG + Intronic
1138522970 16:57582322-57582344 CAGCCTAAGATGCAAGAAGAAGG + Intronic
1138769370 16:59645533-59645555 GAACCCAAGAAACAACATGGTGG - Intergenic
1138897373 16:61223360-61223382 GAACCCAGGAGGCCAGGAGGTGG - Intergenic
1138904520 16:61314852-61314874 TAACCACAGATACAAGAAGGTGG + Intergenic
1141036173 16:80628192-80628214 GAAGGCAAGATGCAGTAAGGAGG - Intronic
1141707580 16:85676365-85676387 GATCCCCAGATGAAAGCAGGAGG + Exonic
1143296141 17:5873416-5873438 GAACAGAAGAAGGAAGAAGGTGG - Intronic
1144967931 17:19089459-19089481 CAAGCCAAGATGCGAGCAGGGGG - Intergenic
1144979986 17:19162604-19162626 CAAGCCAAGATGCGAGCAGGGGG + Intergenic
1144988236 17:19215628-19215650 CAAGCCAAGATGCGAGCAGGGGG - Intronic
1145914449 17:28563347-28563369 GTAGCAATGATGCAAGAAGGAGG + Intronic
1148797430 17:50203741-50203763 AAACCCAAGAAGCAAGGAAGTGG - Intergenic
1149478886 17:56985838-56985860 GAAGTCAAGATACAAGTAGGAGG - Intronic
1152943624 17:83186079-83186101 AAAGCAAAGATGCAAGAAGACGG - Intergenic
1153372476 18:4334646-4334668 GAACACAAAATGCAAGAGAGAGG + Intronic
1153505239 18:5790048-5790070 GACCACAAAATGCAAGAAGAGGG - Intergenic
1155163480 18:23214418-23214440 AAGCCCAAGATGCAAGGAGGTGG - Intronic
1156458924 18:37310470-37310492 GACCCCAAGAGGCCAGAATGGGG - Intronic
1156668238 18:39434835-39434857 AAACTCAAAATGCAACAAGGGGG - Intergenic
1157497844 18:48169207-48169229 GAACCCAGGATGCAAAAAGATGG - Intronic
1159128094 18:64248205-64248227 GATCCCCAGATGCTAGAAAGAGG - Intergenic
1159320842 18:66846062-66846084 GAACCCAGGAAGCAGGGAGGTGG - Intergenic
1159938468 18:74387272-74387294 GAACACAACATGCAAGGAGAGGG - Intergenic
1160522778 18:79518333-79518355 GAACCCCAGAAACATGAAGGAGG + Intronic
1164939057 19:32237672-32237694 GAAGCCAAGAAGGCAGAAGGAGG + Intergenic
1166420693 19:42633794-42633816 GAACCCAGGGTGCAAGAGAGTGG - Intronic
1166715025 19:44961436-44961458 GGAGCCAGGATGCAAGGAGGTGG - Intronic
1168187957 19:54713207-54713229 GTCCCCAAGATGCAGCAAGGAGG + Intergenic
1168213669 19:54909658-54909680 GAACACCAGAAGCAGGAAGGAGG + Intronic
1168273139 19:55261137-55261159 GAAACCAGGATACAAGAAAGAGG + Intergenic
926300853 2:11601101-11601123 GAACCAAAGATCCAAGGAGCTGG - Intronic
930233335 2:48864958-48864980 GAAACTAAGATGCGAGAATGAGG - Intergenic
931345623 2:61443109-61443131 GAACAGAGGATACAAGAAGGTGG + Intronic
931422279 2:62139389-62139411 CACCCCCAAATGCAAGAAGGTGG + Intronic
937240676 2:120460424-120460446 GAACCCAAGAAACAAGATGGTGG - Intergenic
937878826 2:126849989-126850011 GAACCCAAGAAGTAGGAAGGCGG - Intergenic
938051623 2:128177983-128178005 AATCACAAGATGCAAAAAGGAGG - Intronic
938767560 2:134470463-134470485 GAAGCCAAGATGCAAAATGCAGG + Intronic
938917260 2:135954848-135954870 AAACCCAAGATGACAGAAGATGG + Intronic
940896991 2:159090387-159090409 GAGCCACAGAAGCAAGAAGGTGG - Intronic
941191937 2:162395445-162395467 GAACCAGAGAGGGAAGAAGGAGG - Intronic
942168786 2:173269072-173269094 GAAAGCAAGATGGAAGAAAGTGG - Intergenic
943317238 2:186405295-186405317 GAATCTAAGCTGCATGAAGGAGG - Intergenic
945042416 2:205753209-205753231 GAAGCCAAGATAGAAGAAAGAGG + Intronic
947667724 2:231917825-231917847 GAACCCAAGCAGCAAGCGGGAGG - Intergenic
949044976 2:241868288-241868310 GAGCCCAAGGAGCAGGAAGGCGG - Intergenic
1170353874 20:15471001-15471023 GGATCCAAGATGGATGAAGGAGG - Intronic
1170824216 20:19779505-19779527 GATCCCAAGATGAGAGAACGTGG + Intergenic
1171305317 20:24100689-24100711 ATACCCAAGAAGCAGGAAGGGGG + Intergenic
1173744812 20:45428117-45428139 GAATCCAAGATCCAGGGAGGAGG - Intergenic
1178708595 21:34894586-34894608 GAACCCAAACTGCAAGAGAGGGG + Intronic
1178780906 21:35602923-35602945 GAAGCCAGGCTGCAGGAAGGAGG + Intronic
1179334857 21:40441166-40441188 GAGCCCAGGTTCCAAGAAGGAGG + Intronic
1181001032 22:19987803-19987825 GAACCCAAGATACAAAGTGGGGG - Intronic
1183001118 22:34859945-34859967 AAACCCAAAAGACAAGAAGGAGG - Intergenic
1183159953 22:36106203-36106225 AAAACCAAGAGCCAAGAAGGTGG + Intergenic
1184458271 22:44623697-44623719 AAAGCCCAGAGGCAAGAAGGAGG + Intergenic
951808478 3:26673642-26673664 TAAGCCAAGAAGCAAGATGGAGG - Intronic
953682955 3:45053067-45053089 GACCCCAAGAGTCAAGAAGAGGG - Intergenic
954486142 3:50853462-50853484 GACTCCAAGAAGCAGGAAGGAGG - Intronic
955069030 3:55556750-55556772 GGACCCACCATGCATGAAGGCGG + Intronic
955894039 3:63680004-63680026 GAACCAAAAATGTAAGAAGAAGG + Intergenic
956919910 3:73916764-73916786 GAACCAAAAATTCAAGAATGTGG - Intergenic
957345909 3:78961294-78961316 GAACATAAGATGCAAGGAGATGG + Intronic
957450585 3:80377074-80377096 GAACCCAGGATGCCAGAAGGCGG - Intergenic
959268540 3:104174230-104174252 TAATCCAAAATGAAAGAAGGAGG + Intergenic
960329768 3:116344386-116344408 CAGCCAAAGATGGAAGAAGGGGG + Intronic
960549392 3:118957188-118957210 GAACAAAAAATGAAAGAAGGAGG - Intronic
961809778 3:129515085-129515107 GAACCCAAGGTGCAGAAAGATGG - Intronic
962982285 3:140501395-140501417 GAAGGCTAGATGCAGGAAGGAGG + Intronic
963210886 3:142688568-142688590 GAACACAAGATTCAAGACTGTGG - Intronic
963665250 3:148176640-148176662 GAACCCCAGAGGCTAGAAGCTGG - Intergenic
963777504 3:149453840-149453862 CCAGCCAAGATTCAAGAAGGAGG + Intergenic
966760292 3:183412037-183412059 GAAGCCAGAATGCTAGAAGGAGG + Intronic
967334960 3:188334507-188334529 GAACCCAGGAGGCCAGGAGGCGG - Intronic
971503719 4:27343937-27343959 GAACCCAGGAGTCAGGAAGGTGG + Intergenic
974137937 4:57843161-57843183 GGACCAAAGATGCAAGAGAGTGG + Intergenic
978613175 4:110566774-110566796 GAACAGAAGATGGAGGAAGGAGG - Intergenic
979919150 4:126477234-126477256 GGACTCAAGATGCCAGAAGTAGG - Intergenic
980598585 4:134988629-134988651 GTTGCCAAGATGCAAGAAGTGGG - Intergenic
981892661 4:149756718-149756740 AAACCCAACAATCAAGAAGGGGG + Intergenic
982088645 4:151861625-151861647 GGACCCAAGATGCAAAAGGCAGG - Intergenic
982343662 4:154332620-154332642 CAACACATCATGCAAGAAGGTGG + Exonic
985088637 4:186341503-186341525 GAGCACAAGATGCAGAAAGGTGG + Intergenic
986042570 5:4007819-4007841 GACTACAAGTTGCAAGAAGGGGG + Intergenic
986061023 5:4191249-4191271 GAACAGAAGATGGAAGAAGAAGG + Intergenic
986976906 5:13405438-13405460 GAAACTAAGATACAAGATGGAGG + Intergenic
989243580 5:39228120-39228142 GGACCCCAGATCCTAGAAGGTGG - Intronic
990532127 5:56684533-56684555 GAACCCAAGAAGCAGGAATGAGG - Intergenic
990560743 5:56980640-56980662 GAAGCCCAGATGCAAGAAATGGG + Intergenic
990989892 5:61674577-61674599 GATTCCAGGATGCAAGACGGAGG - Intronic
992843617 5:80721606-80721628 AACCCCAAAATGCAAGCAGGTGG - Intronic
995045548 5:107642665-107642687 GAAACCAAGATGGTAGAAGATGG + Intronic
995955708 5:117773691-117773713 GATCCCCAGATGAAAGCAGGAGG - Intergenic
997370038 5:133353756-133353778 CAACCCCAGAAGCAGGAAGGAGG + Intronic
998675458 5:144403083-144403105 GAACCCAAGAGGGAGGCAGGAGG - Intronic
1001269756 5:170302411-170302433 GAACACAAGAAGTTAGAAGGTGG + Intergenic
1002886392 6:1298984-1299006 GAGCCCAAGAAGATAGAAGGTGG + Intergenic
1003969399 6:11283658-11283680 GCACTCAAGATTCAAGAAAGAGG - Intronic
1004962100 6:20801224-20801246 AAACCCAAGATGAAAGAATAAGG - Intronic
1009305182 6:62080840-62080862 CAAACCAAGATGCAGCAAGGTGG - Intronic
1010072116 6:71755585-71755607 TAACCCAAGAAGGAAGAAGCAGG - Intergenic
1010120991 6:72375945-72375967 AAAACCAAGAGGCAAGAATGTGG - Intronic
1012577271 6:100818486-100818508 GAACCCAGGAGGCAAGGTGGAGG + Intronic
1015198249 6:130548133-130548155 AAAGCCAAGAGGCAATAAGGAGG - Intergenic
1015204383 6:130618437-130618459 GAACCCAGGAACCCAGAAGGCGG - Intergenic
1015992577 6:138962112-138962134 GGACAGAAGATGCAAGTAGGTGG - Intronic
1016403953 6:143710266-143710288 GAACCCAAGAAACAACACGGTGG - Intronic
1018146190 6:160891579-160891601 GAAACCAAAAGGCAAGAAAGGGG - Intergenic
1020019167 7:4852278-4852300 GAAGCCAAGATCCCAGAGGGTGG + Intronic
1020214410 7:6178617-6178639 GCTCCCAAGTGGCAAGAAGGCGG - Intronic
1020325342 7:6969845-6969867 CAGCCCCACATGCAAGAAGGTGG - Intergenic
1020751973 7:12152837-12152859 CAACACAACATGCTAGAAGGTGG - Intergenic
1021291208 7:18847662-18847684 GAAGCCAAGAAGCAAAAACGAGG + Intronic
1023594283 7:41812541-41812563 GAACCCAGGAGCCAAGAAGAGGG + Intergenic
1024109294 7:46129059-46129081 AAACCCAAAATGTAGGAAGGGGG - Intergenic
1026579461 7:71601829-71601851 TTACCCAAGAGGGAAGAAGGAGG + Intronic
1028162050 7:87497080-87497102 GATGCCATGATGCAAGATGGTGG - Intergenic
1028166167 7:87540525-87540547 GAACCCAGGAGGCCAGGAGGAGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1031079690 7:117246476-117246498 GAAAACAAGAAGAAAGAAGGAGG - Intergenic
1031560901 7:123236787-123236809 GAACAGAAGAAGAAAGAAGGAGG - Intergenic
1031748588 7:125539486-125539508 GAACCCAAAAAGCAAGAATATGG - Intergenic
1033602300 7:142897006-142897028 GAACCTGAGGGGCAAGAAGGAGG - Intergenic
1033684999 7:143630871-143630893 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033688172 7:143710090-143710112 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033699614 7:143826750-143826772 TAACCCAAGCTGCAACAAGGGGG + Intergenic
1036285264 8:7438988-7439010 GGACCCAAGATACAAGCAGATGG - Intergenic
1036336212 8:7872541-7872563 GGACCCAAGATACAAGCAGATGG + Intergenic
1049860317 8:144893860-144893882 AAACACAAGATGCAGGTAGGAGG - Intronic
1053023115 9:34709313-34709335 GAACCCAAGATGCAAGAAGGAGG - Exonic
1055804726 9:80079766-80079788 GAACACAAGTTTCATGAAGGTGG - Intergenic
1056540047 9:87563457-87563479 CAAGCCAAGATGCAACAGGGAGG - Intronic
1058569025 9:106320748-106320770 GAACCCACCATGGAAGAAAGTGG + Intergenic
1060104944 9:120867848-120867870 GAACCACAGATGTAAGAGGGAGG - Intronic
1061669971 9:132183148-132183170 GCACCCAGGAAGCCAGAAGGAGG - Intronic
1061972172 9:134050734-134050756 GCCCCCAAGATGCAGGATGGGGG - Intronic
1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG + Intronic
1186403836 X:9284046-9284068 GGGCCCAAGCTACAAGAAGGAGG + Intergenic
1189586291 X:42465426-42465448 GAACCCCAGATGCAGGCAGGAGG + Intergenic
1195657331 X:107344700-107344722 GAAGCCAAGAGGCCAGGAGGAGG + Intergenic
1196271078 X:113711698-113711720 AAACACAAGGTGCAAAAAGGTGG - Intergenic
1198020301 X:132650865-132650887 GAAGCTAAGATGCAAGAATCAGG - Intronic
1198035551 X:132798030-132798052 GAAGTCAAGTTGAAAGAAGGAGG + Intronic
1198311575 X:135429689-135429711 GACCCAAAGAAGCAGGAAGGTGG + Intergenic
1198597092 X:138248483-138248505 GAAAGCAAGAGTCAAGAAGGAGG + Intergenic