ID: 1053027720

View in Genome Browser
Species Human (GRCh38)
Location 9:34744207-34744229
Sequence CTGAAGATAACGATGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053027713_1053027720 25 Left 1053027713 9:34744159-34744181 CCTGAGCAATTGTAATTCCAAGC No data
Right 1053027720 9:34744207-34744229 CTGAAGATAACGATGGACCATGG No data
1053027715_1053027720 8 Left 1053027715 9:34744176-34744198 CCAAGCTGGCAAAAGTACTCAAG No data
Right 1053027720 9:34744207-34744229 CTGAAGATAACGATGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053027720 Original CRISPR CTGAAGATAACGATGGACCA TGG Intergenic
No off target data available for this crispr