ID: 1053030918

View in Genome Browser
Species Human (GRCh38)
Location 9:34777315-34777337
Sequence ATGCCAGCACACACCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053030918_1053030922 0 Left 1053030918 9:34777315-34777337 CCCTGGTTGGTGTGTGCTGGCAT No data
Right 1053030922 9:34777338-34777360 TGGTAGTGAATGTGATGGTCTGG No data
1053030918_1053030926 25 Left 1053030918 9:34777315-34777337 CCCTGGTTGGTGTGTGCTGGCAT No data
Right 1053030926 9:34777363-34777385 AGGCCAGTCTCTAGGCCCACAGG No data
1053030918_1053030925 17 Left 1053030918 9:34777315-34777337 CCCTGGTTGGTGTGTGCTGGCAT No data
Right 1053030925 9:34777355-34777377 GTCTGGGCAGGCCAGTCTCTAGG No data
1053030918_1053030924 5 Left 1053030918 9:34777315-34777337 CCCTGGTTGGTGTGTGCTGGCAT No data
Right 1053030924 9:34777343-34777365 GTGAATGTGATGGTCTGGGCAGG No data
1053030918_1053030923 1 Left 1053030918 9:34777315-34777337 CCCTGGTTGGTGTGTGCTGGCAT No data
Right 1053030923 9:34777339-34777361 GGTAGTGAATGTGATGGTCTGGG No data
1053030918_1053030921 -5 Left 1053030918 9:34777315-34777337 CCCTGGTTGGTGTGTGCTGGCAT No data
Right 1053030921 9:34777333-34777355 GGCATTGGTAGTGAATGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053030918 Original CRISPR ATGCCAGCACACACCAACCA GGG (reversed) Intergenic
No off target data available for this crispr