ID: 1053033903

View in Genome Browser
Species Human (GRCh38)
Location 9:34808629-34808651
Sequence CCATCTTGGAAGTAGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053033903_1053033909 9 Left 1053033903 9:34808629-34808651 CCTGGTCTCTACTTCCAAGATGG No data
Right 1053033909 9:34808661-34808683 CACTGCATCTTCCAGAGTTGGGG No data
1053033903_1053033907 7 Left 1053033903 9:34808629-34808651 CCTGGTCTCTACTTCCAAGATGG No data
Right 1053033907 9:34808659-34808681 AGCACTGCATCTTCCAGAGTTGG No data
1053033903_1053033908 8 Left 1053033903 9:34808629-34808651 CCTGGTCTCTACTTCCAAGATGG No data
Right 1053033908 9:34808660-34808682 GCACTGCATCTTCCAGAGTTGGG No data
1053033903_1053033911 28 Left 1053033903 9:34808629-34808651 CCTGGTCTCTACTTCCAAGATGG No data
Right 1053033911 9:34808680-34808702 GGGGAATGCTGTTTTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053033903 Original CRISPR CCATCTTGGAAGTAGAGACC AGG (reversed) Intergenic
No off target data available for this crispr