ID: 1053036848

View in Genome Browser
Species Human (GRCh38)
Location 9:34833343-34833365
Sequence CAATTCCAAAGCAGTACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053036848_1053036851 17 Left 1053036848 9:34833343-34833365 CCTGGGGTACTGCTTTGGAATTG 0: 1
1: 1
2: 1
3: 13
4: 119
Right 1053036851 9:34833383-34833405 CTGCACTGCCTTCAAGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053036848 Original CRISPR CAATTCCAAAGCAGTACCCC AGG (reversed) Intergenic
901291128 1:8125399-8125421 CAATTCCAGCCCAGTACCACAGG + Intergenic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
902518541 1:17002780-17002802 CACGTCCAAAGCAGTCCCCGAGG - Intronic
905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG + Exonic
905768539 1:40622930-40622952 CATTTCCAAAGAAGTACCCTTGG + Exonic
906793921 1:48681691-48681713 CAATCCCAAAACAGTAGACCCGG + Intronic
909224337 1:72997812-72997834 CAATTGTAAAGCTGTACCTCTGG + Intergenic
909953641 1:81750768-81750790 CATTTCCAAACCAGCACCACAGG - Intronic
910677057 1:89825342-89825364 CAATTTCAAAATGGTACCCCAGG - Intronic
911038529 1:93574258-93574280 CACTTCCAGAGCAGTATGCCTGG + Intronic
911047226 1:93638632-93638654 AAATTCCAGAGCTGTACGCCAGG + Intronic
911100914 1:94095182-94095204 CAATCCAAAGGCAGTACCCATGG - Intronic
924426314 1:243953228-243953250 CCAGTCCTCAGCAGTACCCCGGG + Intergenic
1063173274 10:3528943-3528965 CAATTTCTAAGCAGTGCCCTAGG + Intergenic
1066633609 10:37480191-37480213 CAATGCCAAAGCAGCTCCCACGG - Intergenic
1067703876 10:48592711-48592733 CATGTCCAAAGCAGAACTCCTGG + Intronic
1067948273 10:50705409-50705431 CAATTCCACAGCTGTTCCTCCGG + Intergenic
1068547309 10:58362361-58362383 GAATTTCAAAGCAGTACTCTGGG + Intronic
1068721657 10:60252560-60252582 CAATTCTAGAGCAGCACCCCAGG + Intronic
1070659755 10:78296087-78296109 GAATTCCAAAACAATCCCCCTGG - Intergenic
1070810214 10:79293716-79293738 CCCTTCCAAAGCCGTACCCACGG - Intronic
1075570236 10:123536391-123536413 CATCTCCAAAGCAGGACCCAAGG - Intergenic
1076032204 10:127169206-127169228 GAGTTCCAAAGCAGGACCCCAGG + Intronic
1077728382 11:4701098-4701120 CAATTTCAATGCATTAACCCTGG - Intergenic
1078439207 11:11350335-11350357 CATTTGCAAAGCAGTCCTCCTGG - Intronic
1080937925 11:36882835-36882857 CAATTCCCAAGATGTACCCCGGG - Intergenic
1081994485 11:47354949-47354971 GACTCCCAAGGCAGTACCCCGGG + Exonic
1084239284 11:67807451-67807473 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
1091297848 11:134486393-134486415 CATGCCCACAGCAGTACCCCAGG - Intergenic
1091297869 11:134486487-134486509 CATGCCCACAGCAGTACCCCAGG - Intergenic
1091297875 11:134486523-134486545 CATGTCCACAGCAGTGCCCCGGG - Intergenic
1091806274 12:3358470-3358492 CAATTCCCAGGCTGCACCCCAGG + Intergenic
1092081198 12:5717836-5717858 CAACTCTAAAGAAGTAACCCAGG + Intronic
1092409969 12:8245076-8245098 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
1097602110 12:61705956-61705978 CATTTCTAAAACAGTTCCCCAGG - Intergenic
1104251022 12:127094029-127094051 TAATTCAAAAGCAGCATCCCAGG - Intergenic
1109107778 13:58277074-58277096 CATTCACAAAGCAGAACCCCAGG - Intergenic
1110854192 13:80278824-80278846 GAATTCCAGTGCAGTGCCCCCGG + Intergenic
1118096556 14:62543950-62543972 CAATTCCAAAGGAATACACAAGG - Intergenic
1118465362 14:66025663-66025685 CAACTACAAAGCACTACACCAGG + Intergenic
1119725385 14:76919085-76919107 CAGTGCCAAAGCAGTGACCCAGG - Intergenic
1122308152 14:100778427-100778449 CAATTCCAAATCCGGACTCCTGG - Intergenic
1123123895 14:105930686-105930708 CAATTCCAAAGCTGGAGCACTGG - Intronic
1124258617 15:28166351-28166373 TAATTCCAATCCAGTACCACAGG - Intronic
1125114325 15:36071394-36071416 CAATTCCAATCCAGTTCCACAGG - Intergenic
1126359415 15:47830781-47830803 CAATTCCAATCCAATACCACAGG - Intergenic
1127965836 15:63922420-63922442 CAATTCTCAAGCATTTCCCCAGG + Intronic
1128976696 15:72159550-72159572 CAACTCCAAAGCAATGTCCCTGG - Intergenic
1131839961 15:96426629-96426651 CAATTCCAAATGAGTAGTCCTGG + Intergenic
1133350955 16:5099857-5099879 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
1135715172 16:24758498-24758520 AAATTCCAAAGGACGACCCCAGG - Intronic
1141026885 16:80557040-80557062 CATTTCCGAAGCAGCACTCCAGG + Intergenic
1144324070 17:14160991-14161013 AAATTCCAAAGCATTACCAGTGG - Intronic
1144580067 17:16453694-16453716 CAATTCCAAAGCATGGCGCCGGG + Intronic
1145368364 17:22285595-22285617 AAATTCCAAAGCAGAAGTCCTGG + Intergenic
1155620198 18:27769274-27769296 AAACTCCAAAGCAGAACCCCAGG - Intergenic
1157562815 18:48660564-48660586 CATTTCCAAAGCAGTATCCCTGG - Intronic
1158983153 18:62785397-62785419 CAAATTCAAAGCAGTACCTTGGG + Intronic
1163311332 19:16516703-16516725 CAGTTCCAAAGCAGCGTCCCGGG - Intronic
930338999 2:50087820-50087842 CAATTACAGAGCAGTACCATTGG + Intronic
931497527 2:62825868-62825890 CAATTGGAAAGCGGTAACCCAGG - Intronic
932517343 2:72365860-72365882 CAGTTCTAAAGCAGTACCCTTGG - Intronic
934679049 2:96269439-96269461 CAATTCCCAAGCACTCCCCCAGG - Intronic
936530046 2:113269777-113269799 CAATTAAAAACAAGTACCCCAGG + Intronic
937164536 2:119799698-119799720 TAATTCCAAAACATTTCCCCTGG + Intronic
937197185 2:120168988-120169010 CAATTACAAAGCATTACCGTCGG - Intronic
940480233 2:154219683-154219705 CCATTCCCAAAAAGTACCCCTGG - Intronic
944198905 2:197084538-197084560 CAAATCCAAATCAGAAGCCCTGG + Intronic
948335195 2:237202031-237202053 CAGTTCCAAGACAGTACCCACGG - Intergenic
1170597216 20:17815118-17815140 TGAATCCAAAGCAATACCCCCGG - Intergenic
1170928378 20:20746152-20746174 CAAATCCATAGAAGTACCCTTGG + Intergenic
1173895369 20:46546558-46546580 CAATTCCCATGCAGTACCTGAGG + Intronic
1181306915 22:21922362-21922384 TAATTCCGAAGCAGTATTCCAGG - Exonic
1182292129 22:29288499-29288521 CAATTCCAAGGCACTAACCAAGG - Intronic
1182354822 22:29718062-29718084 CAGTTCTAAATCAGAACCCCTGG - Intergenic
1184968372 22:47997577-47997599 CATTTCAAAAGCAGGAACCCTGG + Intergenic
949093228 3:54425-54447 CAATACCACAGCAGTCCACCTGG - Intergenic
954458949 3:50615518-50615540 CAACTCCAAAGCACAACCTCAGG - Intronic
957055208 3:75437200-75437222 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
960583062 3:119296781-119296803 GAATGGCAAACCAGTACCCCGGG + Intronic
961299619 3:125914473-125914495 CAAAAGCAAAGCAGTGCCCCTGG + Intergenic
961553287 3:127680935-127680957 CCCTTCCCAAGCTGTACCCCAGG - Intergenic
961888883 3:130113590-130113612 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
962154819 3:132935062-132935084 CATATTTAAAGCAGTACCCCAGG + Intergenic
962344850 3:134611354-134611376 CAAGGCCAAAGCAAGACCCCTGG + Intronic
962390849 3:134971408-134971430 AAATTCCAGAGCAGAACCCAGGG - Intronic
962926711 3:140000250-140000272 CAATTCTAAAGTACTACCCCAGG - Intronic
964282607 3:155082521-155082543 CAATTCCATATCATAACCCCAGG + Intronic
968998031 4:3957510-3957532 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
969519905 4:7670615-7670637 GAATTCCAAAGCAGTTACACTGG - Intronic
969755978 4:9151148-9151170 CAAAAGCAAAGCAGTGCCCCTGG + Intergenic
969816303 4:9690311-9690333 CAAAAGCAAAGCAGTGCCCCTGG + Intergenic
974029364 4:56762360-56762382 CAATTCCAACACAGGACCCCAGG - Intergenic
975979742 4:80144040-80144062 AAATTCCCAGGCAGTACTCCTGG + Intergenic
982624691 4:157751807-157751829 CAATTTCATAGCATTTCCCCAGG + Intergenic
982796620 4:159653923-159653945 CAACTCTAAAGCAGTAACTCTGG + Intergenic
984331304 4:178323027-178323049 CAATAGCAAAGCACTACCCCTGG + Intergenic
987052161 5:14156535-14156557 CAATTCCAATACAGTACCACAGG + Intronic
987792690 5:22588495-22588517 TAATCCCAAACCAGTACCTCAGG - Intronic
988854464 5:35214423-35214445 CAAATACAAAGCAGTGCCACAGG + Intronic
990846020 5:60140601-60140623 CAATTCCACAACAGTACTACTGG - Intronic
992162807 5:74018850-74018872 CAATACTTAAGCAGTACTCCAGG + Intergenic
993661254 5:90637799-90637821 TAATTCAAAAGCAGTGACCCCGG + Exonic
998250649 5:140549857-140549879 CCATTCCAAAGCAGGACTCTTGG + Intronic
1000569230 5:162891401-162891423 CAACTCTAAATCATTACCCCAGG + Intergenic
1002016706 5:176329859-176329881 CAATTCCAATCCAGTACCACAGG - Intronic
1009044377 6:58220085-58220107 AAATTTTAAAGCAGCACCCCAGG - Intergenic
1009220202 6:60974331-60974353 AAATTTTAAAGCAGCACCCCAGG - Intergenic
1013262448 6:108459095-108459117 GAATCACAAAGCATTACCCCTGG - Intronic
1015160633 6:130149082-130149104 CAATTCCAAACCAATACCACAGG + Intronic
1020902924 7:14027859-14027881 CAATACCAAAGAAGTAGCACGGG + Intergenic
1024838744 7:53558343-53558365 ATATTCCAAATCTGTACCCCTGG - Intergenic
1029915873 7:104209030-104209052 CAATTCAAAAGCATTTGCCCAGG + Intergenic
1032577925 7:133075390-133075412 CCCTTCCAAAGCAGCACCCATGG + Intronic
1032609951 7:133402249-133402271 CACTTACAAAGCAGTACACGTGG - Intronic
1036850336 8:12196163-12196185 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
1036871700 8:12438436-12438458 CAAAAGCAAAGCAGTGCCCCTGG - Intergenic
1044646692 8:94450959-94450981 CAATTCTAATATAGTACCCCAGG - Intronic
1049341370 8:142114387-142114409 CAGCTCCAAGGCAGTGCCCCAGG + Intergenic
1049864665 8:144926675-144926697 CAATTCCAGTCCAGTACCACAGG - Intergenic
1053025319 9:34724281-34724303 CAATTCCAAAGCTGTACCCCAGG - Exonic
1053036848 9:34833343-34833365 CAATTCCAAAGCAGTACCCCAGG - Intergenic
1053341796 9:37342529-37342551 CAATTACACTGCAGTGCCCCAGG - Intronic
1055140008 9:72865908-72865930 CATTTCCAAAGCAGCACACATGG + Intergenic
1055752151 9:79518580-79518602 CAATTCCAATTCAGTACTGCAGG - Intergenic
1056448185 9:86686889-86686911 CAATTCCAATGCAGGAGCCAGGG + Intergenic
1056589582 9:87955341-87955363 CAATTCCAATTCAGCACCACAGG + Intergenic
1061465161 9:130772613-130772635 AAATTCCACCTCAGTACCCCAGG - Intronic
1062115575 9:134806386-134806408 CAATCCCAAGGAAATACCCCTGG - Intronic
1191583492 X:62792415-62792437 CACTTCCAAAGCAGTTTCACAGG + Intergenic
1192382810 X:70635865-70635887 CAATACCAGATCTGTACCCCTGG + Intronic
1194494344 X:94593109-94593131 CAATTCAAATTCAGTACCACAGG + Intergenic
1195763985 X:108276982-108277004 GAATTTCAAAGAAGTACCACTGG + Intronic
1197283147 X:124561788-124561810 CATTTCCAAAGCAGAGCCCTGGG + Exonic
1202188894 Y:22220533-22220555 CATTTCCAAACCAGTAGTCCAGG + Intergenic