ID: 1053040123

View in Genome Browser
Species Human (GRCh38)
Location 9:34863119-34863141
Sequence GGGAACCTTAGAAATCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053040123_1053040135 23 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040135 9:34863165-34863187 CAGTATCTCTAGACTCACTGGGG No data
1053040123_1053040137 29 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG No data
1053040123_1053040136 24 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040136 9:34863166-34863188 AGTATCTCTAGACTCACTGGGGG No data
1053040123_1053040130 0 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040130 9:34863142-34863164 AACTCCAGGGTCTGGCTCCTGGG No data
1053040123_1053040129 -1 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040129 9:34863141-34863163 CAACTCCAGGGTCTGGCTCCTGG No data
1053040123_1053040126 -8 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040126 9:34863134-34863156 AGGTTCCCAACTCCAGGGTCTGG No data
1053040123_1053040134 22 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040134 9:34863164-34863186 GCAGTATCTCTAGACTCACTGGG No data
1053040123_1053040133 21 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040133 9:34863163-34863185 GGCAGTATCTCTAGACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053040123 Original CRISPR GGGAACCTTAGAAATCTACC TGG (reversed) Intergenic
No off target data available for this crispr