ID: 1053040127

View in Genome Browser
Species Human (GRCh38)
Location 9:34863139-34863161
Sequence AGGAGCCAGACCCTGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053040127_1053040134 2 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040134 9:34863164-34863186 GCAGTATCTCTAGACTCACTGGG No data
1053040127_1053040133 1 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040133 9:34863163-34863185 GGCAGTATCTCTAGACTCACTGG No data
1053040127_1053040138 12 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040138 9:34863174-34863196 TAGACTCACTGGGGGCTTGGAGG No data
1053040127_1053040136 4 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040136 9:34863166-34863188 AGTATCTCTAGACTCACTGGGGG No data
1053040127_1053040139 30 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040139 9:34863192-34863214 GGAGGAACTTGACACCCTGAAGG No data
1053040127_1053040135 3 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040135 9:34863165-34863187 CAGTATCTCTAGACTCACTGGGG No data
1053040127_1053040137 9 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053040127 Original CRISPR AGGAGCCAGACCCTGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr