ID: 1053040131

View in Genome Browser
Species Human (GRCh38)
Location 9:34863146-34863168
Sequence ACTGCCCAGGAGCCAGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053040131_1053040138 5 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040138 9:34863174-34863196 TAGACTCACTGGGGGCTTGGAGG No data
1053040131_1053040141 28 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040141 9:34863197-34863219 AACTTGACACCCTGAAGGGAAGG No data
1053040131_1053040139 23 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040139 9:34863192-34863214 GGAGGAACTTGACACCCTGAAGG No data
1053040131_1053040136 -3 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040136 9:34863166-34863188 AGTATCTCTAGACTCACTGGGGG No data
1053040131_1053040135 -4 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040135 9:34863165-34863187 CAGTATCTCTAGACTCACTGGGG No data
1053040131_1053040140 24 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040140 9:34863193-34863215 GAGGAACTTGACACCCTGAAGGG No data
1053040131_1053040134 -5 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040134 9:34863164-34863186 GCAGTATCTCTAGACTCACTGGG No data
1053040131_1053040137 2 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG No data
1053040131_1053040133 -6 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040133 9:34863163-34863185 GGCAGTATCTCTAGACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053040131 Original CRISPR ACTGCCCAGGAGCCAGACCC TGG (reversed) Intergenic
No off target data available for this crispr