ID: 1053040137

View in Genome Browser
Species Human (GRCh38)
Location 9:34863171-34863193
Sequence CTCTAGACTCACTGGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053040131_1053040137 2 Left 1053040131 9:34863146-34863168 CCAGGGTCTGGCTCCTGGGCAGT No data
Right 1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG No data
1053040123_1053040137 29 Left 1053040123 9:34863119-34863141 CCAGGTAGATTTCTAAGGTTCCC No data
Right 1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG No data
1053040128_1053040137 8 Left 1053040128 9:34863140-34863162 CCAACTCCAGGGTCTGGCTCCTG No data
Right 1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG No data
1053040127_1053040137 9 Left 1053040127 9:34863139-34863161 CCCAACTCCAGGGTCTGGCTCCT No data
Right 1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053040137 Original CRISPR CTCTAGACTCACTGGGGGCT TGG Intergenic
No off target data available for this crispr