ID: 1053040137 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:34863171-34863193 |
Sequence | CTCTAGACTCACTGGGGGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1053040131_1053040137 | 2 | Left | 1053040131 | 9:34863146-34863168 | CCAGGGTCTGGCTCCTGGGCAGT | No data | ||
Right | 1053040137 | 9:34863171-34863193 | CTCTAGACTCACTGGGGGCTTGG | No data | ||||
1053040123_1053040137 | 29 | Left | 1053040123 | 9:34863119-34863141 | CCAGGTAGATTTCTAAGGTTCCC | No data | ||
Right | 1053040137 | 9:34863171-34863193 | CTCTAGACTCACTGGGGGCTTGG | No data | ||||
1053040128_1053040137 | 8 | Left | 1053040128 | 9:34863140-34863162 | CCAACTCCAGGGTCTGGCTCCTG | No data | ||
Right | 1053040137 | 9:34863171-34863193 | CTCTAGACTCACTGGGGGCTTGG | No data | ||||
1053040127_1053040137 | 9 | Left | 1053040127 | 9:34863139-34863161 | CCCAACTCCAGGGTCTGGCTCCT | No data | ||
Right | 1053040137 | 9:34863171-34863193 | CTCTAGACTCACTGGGGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1053040137 | Original CRISPR | CTCTAGACTCACTGGGGGCT TGG | Intergenic | ||
No off target data available for this crispr |