ID: 1053040399

View in Genome Browser
Species Human (GRCh38)
Location 9:34865707-34865729
Sequence CTGGGCTGATACCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053040399_1053040405 -2 Left 1053040399 9:34865707-34865729 CCAAAATCAAGGTATCAGCCCAG No data
Right 1053040405 9:34865728-34865750 AGGGTCTGTGGTTTCATCTGAGG No data
1053040399_1053040409 14 Left 1053040399 9:34865707-34865729 CCAAAATCAAGGTATCAGCCCAG No data
Right 1053040409 9:34865744-34865766 TCTGAGGTTTCAACTGGGGAAGG No data
1053040399_1053040407 9 Left 1053040399 9:34865707-34865729 CCAAAATCAAGGTATCAGCCCAG No data
Right 1053040407 9:34865739-34865761 TTTCATCTGAGGTTTCAACTGGG No data
1053040399_1053040408 10 Left 1053040399 9:34865707-34865729 CCAAAATCAAGGTATCAGCCCAG No data
Right 1053040408 9:34865740-34865762 TTCATCTGAGGTTTCAACTGGGG No data
1053040399_1053040406 8 Left 1053040399 9:34865707-34865729 CCAAAATCAAGGTATCAGCCCAG No data
Right 1053040406 9:34865738-34865760 GTTTCATCTGAGGTTTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053040399 Original CRISPR CTGGGCTGATACCTTGATTT TGG (reversed) Intergenic
No off target data available for this crispr