ID: 1053042233

View in Genome Browser
Species Human (GRCh38)
Location 9:34884676-34884698
Sequence TTGGAGATCCTCAGACACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053042233_1053042237 4 Left 1053042233 9:34884676-34884698 CCCTTGTGTCTGAGGATCTCCAA No data
Right 1053042237 9:34884703-34884725 ATGGAATTTTGAGCAGAGCAAGG No data
1053042233_1053042239 25 Left 1053042233 9:34884676-34884698 CCCTTGTGTCTGAGGATCTCCAA No data
Right 1053042239 9:34884724-34884746 GGAGTTTCTGCTCCTGCTCAGGG No data
1053042233_1053042238 24 Left 1053042233 9:34884676-34884698 CCCTTGTGTCTGAGGATCTCCAA No data
Right 1053042238 9:34884723-34884745 AGGAGTTTCTGCTCCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053042233 Original CRISPR TTGGAGATCCTCAGACACAA GGG (reversed) Intergenic