ID: 1053042234

View in Genome Browser
Species Human (GRCh38)
Location 9:34884677-34884699
Sequence GTTGGAGATCCTCAGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053042234_1053042237 3 Left 1053042234 9:34884677-34884699 CCTTGTGTCTGAGGATCTCCAAC No data
Right 1053042237 9:34884703-34884725 ATGGAATTTTGAGCAGAGCAAGG No data
1053042234_1053042238 23 Left 1053042234 9:34884677-34884699 CCTTGTGTCTGAGGATCTCCAAC No data
Right 1053042238 9:34884723-34884745 AGGAGTTTCTGCTCCTGCTCAGG No data
1053042234_1053042239 24 Left 1053042234 9:34884677-34884699 CCTTGTGTCTGAGGATCTCCAAC No data
Right 1053042239 9:34884724-34884746 GGAGTTTCTGCTCCTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053042234 Original CRISPR GTTGGAGATCCTCAGACACA AGG (reversed) Intergenic