ID: 1053042236

View in Genome Browser
Species Human (GRCh38)
Location 9:34884695-34884717
Sequence TGCTCAAAATTCCATCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053042236_1053042243 25 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042243 9:34884743-34884765 AGGGACTCCCAGTCCCTGGAGGG No data
1053042236_1053042242 24 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042242 9:34884742-34884764 CAGGGACTCCCAGTCCCTGGAGG No data
1053042236_1053042238 5 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042238 9:34884723-34884745 AGGAGTTTCTGCTCCTGCTCAGG No data
1053042236_1053042244 28 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042244 9:34884746-34884768 GACTCCCAGTCCCTGGAGGGTGG No data
1053042236_1053042239 6 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042239 9:34884724-34884746 GGAGTTTCTGCTCCTGCTCAGGG No data
1053042236_1053042241 21 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042241 9:34884739-34884761 GCTCAGGGACTCCCAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053042236 Original CRISPR TGCTCAAAATTCCATCTTGT TGG (reversed) Intergenic