ID: 1053042239

View in Genome Browser
Species Human (GRCh38)
Location 9:34884724-34884746
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053042233_1053042239 25 Left 1053042233 9:34884676-34884698 CCCTTGTGTCTGAGGATCTCCAA No data
Right 1053042239 9:34884724-34884746 GGAGTTTCTGCTCCTGCTCAGGG No data
1053042236_1053042239 6 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042239 9:34884724-34884746 GGAGTTTCTGCTCCTGCTCAGGG No data
1053042234_1053042239 24 Left 1053042234 9:34884677-34884699 CCTTGTGTCTGAGGATCTCCAAC No data
Right 1053042239 9:34884724-34884746 GGAGTTTCTGCTCCTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053042239 Original CRISPR GGAGTTTCTGCTCCTGCTCA GGG Intergenic