ID: 1053042241

View in Genome Browser
Species Human (GRCh38)
Location 9:34884739-34884761
Sequence GCTCAGGGACTCCCAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053042236_1053042241 21 Left 1053042236 9:34884695-34884717 CCAACAAGATGGAATTTTGAGCA No data
Right 1053042241 9:34884739-34884761 GCTCAGGGACTCCCAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053042241 Original CRISPR GCTCAGGGACTCCCAGTCCC TGG Intergenic