ID: 1053042244 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:34884746-34884768 |
| Sequence | GACTCCCAGTCCCTGGAGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053042236_1053042244 | 28 | Left | 1053042236 | 9:34884695-34884717 | CCAACAAGATGGAATTTTGAGCA | No data | ||
| Right | 1053042244 | 9:34884746-34884768 | GACTCCCAGTCCCTGGAGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053042244 | Original CRISPR | GACTCCCAGTCCCTGGAGGG TGG | Intergenic | ||