ID: 1053045784

View in Genome Browser
Species Human (GRCh38)
Location 9:34915926-34915948
Sequence AACAGCACCAGGGTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053045784_1053045792 24 Left 1053045784 9:34915926-34915948 CCACCACCAACCCTGGTGCTGTT No data
Right 1053045792 9:34915973-34915995 CAAAATCAGGTGGTTTTATAAGG No data
1053045784_1053045794 26 Left 1053045784 9:34915926-34915948 CCACCACCAACCCTGGTGCTGTT No data
Right 1053045794 9:34915975-34915997 AAATCAGGTGGTTTTATAAGGGG No data
1053045784_1053045791 14 Left 1053045784 9:34915926-34915948 CCACCACCAACCCTGGTGCTGTT No data
Right 1053045791 9:34915963-34915985 TGAGTTCTCACAAAATCAGGTGG No data
1053045784_1053045793 25 Left 1053045784 9:34915926-34915948 CCACCACCAACCCTGGTGCTGTT No data
Right 1053045793 9:34915974-34915996 AAAATCAGGTGGTTTTATAAGGG No data
1053045784_1053045790 11 Left 1053045784 9:34915926-34915948 CCACCACCAACCCTGGTGCTGTT No data
Right 1053045790 9:34915960-34915982 GACTGAGTTCTCACAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053045784 Original CRISPR AACAGCACCAGGGTTGGTGG TGG (reversed) Intergenic