ID: 1053049184

View in Genome Browser
Species Human (GRCh38)
Location 9:34944569-34944591
Sequence CTGCAGTCTTAGGGTTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053049179_1053049184 8 Left 1053049179 9:34944538-34944560 CCAGCTCTTACTAGAGAAGAGTA No data
Right 1053049184 9:34944569-34944591 CTGCAGTCTTAGGGTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053049184 Original CRISPR CTGCAGTCTTAGGGTTCAGA GGG Intergenic
No off target data available for this crispr