ID: 1053050404

View in Genome Browser
Species Human (GRCh38)
Location 9:34957482-34957504
Sequence CAGAAGGCCAGCAATTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053050404_1053050409 6 Left 1053050404 9:34957482-34957504 CCCTCAGAATTGCTGGCCTTCTG No data
Right 1053050409 9:34957511-34957533 TAGCTGTTTGGATATTGTGAGGG No data
1053050404_1053050408 5 Left 1053050404 9:34957482-34957504 CCCTCAGAATTGCTGGCCTTCTG No data
Right 1053050408 9:34957510-34957532 CTAGCTGTTTGGATATTGTGAGG No data
1053050404_1053050407 -6 Left 1053050404 9:34957482-34957504 CCCTCAGAATTGCTGGCCTTCTG No data
Right 1053050407 9:34957499-34957521 CTTCTGACAAGCTAGCTGTTTGG No data
1053050404_1053050410 12 Left 1053050404 9:34957482-34957504 CCCTCAGAATTGCTGGCCTTCTG No data
Right 1053050410 9:34957517-34957539 TTTGGATATTGTGAGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053050404 Original CRISPR CAGAAGGCCAGCAATTCTGA GGG (reversed) Intergenic
No off target data available for this crispr