ID: 1053052212

View in Genome Browser
Species Human (GRCh38)
Location 9:34971427-34971449
Sequence AGCCCTCTACAGTGCCACGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053052212_1053052223 28 Left 1053052212 9:34971427-34971449 CCGCCGTGGCACTGTAGAGGGCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1053052223 9:34971478-34971500 AGCAGAAGCAGGAACCTCGGTGG 0: 1
1: 0
2: 3
3: 36
4: 237
1053052212_1053052221 17 Left 1053052212 9:34971427-34971449 CCGCCGTGGCACTGTAGAGGGCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1053052221 9:34971467-34971489 GAGGAGAAGGAAGCAGAAGCAGG 0: 1
1: 1
2: 25
3: 282
4: 1994
1053052212_1053052220 4 Left 1053052212 9:34971427-34971449 CCGCCGTGGCACTGTAGAGGGCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1053052220 9:34971454-34971476 CCAGGAGGTACAGGAGGAGAAGG 0: 1
1: 1
2: 7
3: 74
4: 973
1053052212_1053052222 25 Left 1053052212 9:34971427-34971449 CCGCCGTGGCACTGTAGAGGGCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1053052222 9:34971475-34971497 GGAAGCAGAAGCAGGAACCTCGG 0: 1
1: 1
2: 5
3: 73
4: 585
1053052212_1053052216 -5 Left 1053052212 9:34971427-34971449 CCGCCGTGGCACTGTAGAGGGCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1053052216 9:34971445-34971467 GGGCTCCGTCCAGGAGGTACAGG 0: 1
1: 1
2: 1
3: 8
4: 107
1053052212_1053052217 -2 Left 1053052212 9:34971427-34971449 CCGCCGTGGCACTGTAGAGGGCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1053052217 9:34971448-34971470 CTCCGTCCAGGAGGTACAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053052212 Original CRISPR AGCCCTCTACAGTGCCACGG CGG (reversed) Exonic
902086438 1:13866564-13866586 AGCACTCTGCAGGGCCATGGAGG - Intergenic
902851448 1:19160940-19160962 AGCCCTCTACTGTGCGGCAGAGG + Exonic
905908086 1:41633086-41633108 AGCCCTCTGACCTGCCACGGAGG - Intronic
923376801 1:233372164-233372186 AGCTTTCTGCACTGCCACGGGGG + Intronic
1063611758 10:7568786-7568808 AGCCCTCTACAGACCAACAGGGG + Intronic
1066198613 10:33125561-33125583 AGCCCTCTCCAGGGCCAGAGAGG + Intergenic
1067082464 10:43219357-43219379 AGACCCCTAGGGTGCCACGGAGG + Intronic
1070309630 10:75263872-75263894 AGCCCTGAACTGTGCCACTGAGG - Intergenic
1076747543 10:132521985-132522007 AACCCTCAACAGACCCACGGGGG - Intergenic
1076747598 10:132522246-132522268 AACCCTCAACAGACCCACGGGGG - Intergenic
1077281253 11:1747258-1747280 AGCCCTCTTCAGCCCCACGCTGG + Intronic
1082031346 11:47606486-47606508 AGCTCTCTACAGAGCCACACTGG + Intergenic
1083926422 11:65809723-65809745 TGCCCCCAACAGTGCCTCGGTGG + Intergenic
1089273314 11:117316021-117316043 AGCCCGCTACATCGGCACGGCGG + Exonic
1094205254 12:27832772-27832794 ACCTCTCTACACTGCCACTGTGG + Intergenic
1095922257 12:47543133-47543155 AGCCCTCCTCATGGCCACGGTGG + Intergenic
1100361720 12:93885467-93885489 ACCCCTCCACAGTGCCACTGAGG - Intronic
1103947991 12:124537737-124537759 AGCCCTCTCCAGTGCCTGGCAGG + Intronic
1104092078 12:125525832-125525854 ACCCCTCCACAGTCCCAGGGTGG + Intronic
1113926898 13:113946745-113946767 ACCCCTCTACTGTTCCAGGGTGG - Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122992241 14:105241935-105241957 AGCACGGCACAGTGCCACGGGGG + Intronic
1124098569 15:26671787-26671809 TCCCCTCCCCAGTGCCACGGGGG + Intronic
1124223047 15:27866166-27866188 AGCCCTCTACATTGCCTGGGTGG - Intronic
1135052608 16:19204770-19204792 TGCCCTCAACAGAGCCACTGAGG - Intronic
1137663572 16:50232675-50232697 AGCCCTCTCCAGTGACTAGGAGG + Intronic
1138401414 16:56747881-56747903 AGCCTCCTAGAGTGCCACAGTGG + Intronic
1140807783 16:78549095-78549117 AGCTCTCTAGAGTGTCACTGTGG + Intronic
1141410200 16:83827954-83827976 GGGCCCCTACAGTGCCACGATGG + Intergenic
1142239508 16:88938807-88938829 AGCCTCCCACAGTGCCAGGGTGG - Intronic
1147917653 17:43898330-43898352 ATCCCTCCCCAGTGCCACGGGGG - Exonic
1151560031 17:74865005-74865027 AGCCTTCTCCAGGCCCACGGTGG - Intronic
1151667803 17:75555714-75555736 AGCCCTCCTCAGTGGCATGGGGG - Intronic
1152563287 17:81089290-81089312 AGCCACCTCCAGTGCCTCGGTGG + Intronic
1160861376 19:1238406-1238428 AGTCCTCCACAGTGCCAGAGGGG - Intergenic
1162064217 19:8115341-8115363 AGTCCTATACAGTGCCCCGGGGG - Intronic
1164144771 19:22505217-22505239 AGCCCTCTCTACTGCCACTGGGG - Intronic
1164455449 19:28403067-28403089 AGCCCTCTTCAGGGGCTCGGTGG - Intergenic
1165110469 19:33499320-33499342 CCACCTCTACAGGGCCACGGGGG - Intronic
1165685651 19:37817578-37817600 AGCCCTGTAGGGTGCCACGTGGG - Intergenic
925227714 2:2200089-2200111 AGCTTCCTATAGTGCCACGGTGG - Intronic
926281322 2:11449340-11449362 AGCCCTCTGCATTGCCCTGGGGG - Intronic
927495166 2:23547073-23547095 AACCCACCACAGTGCCACAGCGG + Intronic
929154588 2:38778012-38778034 ATCCCTCTCCATTGCCACGACGG - Intronic
929602393 2:43212636-43212658 AGGCCTGGACAGTGCCCCGGTGG + Intergenic
937217759 2:120323525-120323547 TCCCCTCTACCCTGCCACGGAGG - Intergenic
938403686 2:131015220-131015242 AGCCATCTACAGTCCCAAGTGGG - Intronic
948606245 2:239137484-239137506 CCTCCTCTACAGTGCCAGGGAGG - Intronic
1169023937 20:2351377-2351399 AGGCCTTAACAGTGCCTCGGTGG + Intergenic
1172461004 20:35118678-35118700 GTACCTCTACCGTGCCACGGGGG - Exonic
1176098823 20:63355931-63355953 AGTCCTCTACAGGGCCTTGGTGG - Intronic
1178349999 21:31866113-31866135 AGCCCTGCCCAGGGCCACGGAGG + Intergenic
1184550737 22:45203019-45203041 AGTCCTCTTCAGTCCCACAGGGG + Exonic
1184608970 22:45590512-45590534 AGCCCCCTGCAGAGCCACAGTGG + Intronic
949282459 3:2362291-2362313 TGCCCTCTGCAGAGCCATGGCGG + Intronic
952957752 3:38567828-38567850 TGCCATCTACAGTGCCTCAGTGG - Intronic
967343516 3:188427649-188427671 AGCCCACCACAGTGCCACAAAGG - Intronic
969506710 4:7592517-7592539 AGCTCTGGCCAGTGCCACGGGGG + Intronic
982116851 4:152105198-152105220 AGCCCTCTGCAGAGCCAGGCTGG + Intergenic
985909127 5:2865207-2865229 AGCCCTCTCCAGTGACAGGCGGG - Intergenic
990456397 5:55993182-55993204 AATCCTCTACAGTGGCAGGGAGG - Intronic
995417586 5:111927180-111927202 AGCCCTCTCCTGCGCCACTGAGG + Intronic
997263771 5:132483210-132483232 AGCCCTCAACAGGCCCAGGGAGG - Exonic
1003563223 6:7201320-7201342 AGCCCTGTGAAGTGCTACGGTGG - Intronic
1005886473 6:30101419-30101441 AGCCCTGTGCAGGTCCACGGGGG + Intergenic
1010001444 6:70954362-70954384 AGCCCTCTACAGTGAAAGGATGG + Intronic
1010884421 6:81218455-81218477 TGCACTCTGCAGTGCCACAGGGG + Intergenic
1011918720 6:92544275-92544297 AGACCTATACAGTGCAAAGGGGG - Intergenic
1022712980 7:32869734-32869756 ACCCATCTACAGTGCCAGAGGGG + Exonic
1023833008 7:44051080-44051102 AGCCCTGTCCTGTGCCACTGGGG - Intronic
1035076138 7:156178886-156178908 AGTCCTCCTCAGGGCCACGGAGG + Intergenic
1041144424 8:54858941-54858963 ACTCCTTTACAGTGCCATGGCGG - Intergenic
1049432156 8:142570158-142570180 AGCCCTGTGCAGTGCCACAGGGG + Intergenic
1052739616 9:32381011-32381033 AGTCCTCTAGAGTGGCACGGAGG - Intergenic
1053052212 9:34971427-34971449 AGCCCTCTACAGTGCCACGGCGG - Exonic
1061041613 9:128144128-128144150 AGCCCTCTGCATTGCCATGATGG - Intergenic
1061496963 9:130980637-130980659 AGCCCTGCACAGTGGTACGGAGG + Intergenic
1061506646 9:131035485-131035507 CTCACTCTACAGTACCACGGGGG + Intronic