ID: 1053052869

View in Genome Browser
Species Human (GRCh38)
Location 9:34976406-34976428
Sequence AGTCTCTGCCTCCCATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 582}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053052869_1053052877 9 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052877 9:34976438-34976460 CTGTGGGTTTGGGGGCCCCGAGG 0: 1
1: 0
2: 1
3: 27
4: 263
1053052869_1053052876 1 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052876 9:34976430-34976452 AGCAAGAGCTGTGGGTTTGGGGG 0: 1
1: 1
2: 2
3: 26
4: 335
1053052869_1053052879 18 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052879 9:34976447-34976469 TGGGGGCCCCGAGGGTGCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 334
1053052869_1053052875 0 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052875 9:34976429-34976451 TAGCAAGAGCTGTGGGTTTGGGG 0: 1
1: 1
2: 2
3: 15
4: 237
1053052869_1053052872 -7 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052872 9:34976422-34976444 AGAGACTTAGCAAGAGCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 194
1053052869_1053052878 10 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052878 9:34976439-34976461 TGTGGGTTTGGGGGCCCCGAGGG 0: 1
1: 0
2: 3
3: 13
4: 154
1053052869_1053052884 27 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052884 9:34976456-34976478 CGAGGGTGCCCTGGAGGTGATGG 0: 1
1: 0
2: 1
3: 28
4: 323
1053052869_1053052880 21 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 341
1053052869_1053052871 -8 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052871 9:34976421-34976443 CAGAGACTTAGCAAGAGCTGTGG 0: 1
1: 0
2: 2
3: 20
4: 222
1053052869_1053052873 -2 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052873 9:34976427-34976449 CTTAGCAAGAGCTGTGGGTTTGG 0: 1
1: 0
2: 2
3: 12
4: 183
1053052869_1053052885 30 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052885 9:34976459-34976481 GGGTGCCCTGGAGGTGATGGAGG 0: 1
1: 0
2: 2
3: 51
4: 541
1053052869_1053052874 -1 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052874 9:34976428-34976450 TTAGCAAGAGCTGTGGGTTTGGG 0: 1
1: 0
2: 1
3: 22
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053052869 Original CRISPR AGTCTCTGCCTCCCATGGCC AGG (reversed) Intronic