ID: 1053052880

View in Genome Browser
Species Human (GRCh38)
Location 9:34976450-34976472
Sequence GGGCCCCGAGGGTGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053052869_1053052880 21 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 341
1053052870_1053052880 16 Left 1053052870 9:34976411-34976433 CCATGGGAGGCAGAGACTTAGCA 0: 1
1: 0
2: 1
3: 19
4: 283
Right 1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 341
1053052868_1053052880 22 Left 1053052868 9:34976405-34976427 CCCTGGCCATGGGAGGCAGAGAC 0: 1
1: 0
2: 2
3: 85
4: 568
Right 1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053052880 Original CRISPR GGGCCCCGAGGGTGCCCTGG AGG Intronic
900353335 1:2247761-2247783 GGGCCCCACAGGTGCCCTTGGGG + Intronic
901465363 1:9417798-9417820 GGCCCCAGAGGCTGTCCTGGTGG - Intergenic
901629659 1:10641954-10641976 GGCCCCGGAGCGTGGCCTGGAGG + Intronic
901680800 1:10911655-10911677 GGGCCCTGAGACTGCCCTGTGGG - Intergenic
902614562 1:17616720-17616742 GGTCCACTGGGGTGCCCTGGGGG + Intronic
902736309 1:18403607-18403629 GAGCCCCCAGTGTGGCCTGGGGG + Intergenic
903137582 1:21319498-21319520 TGGTGCCGGGGGTGCCCTGGTGG - Intronic
905802783 1:40856097-40856119 GGGCCCAAAGTGTGCCCTGATGG - Intergenic
906138190 1:43515283-43515305 GTTCCCCAAGTGTGCCCTGGTGG + Intergenic
910127543 1:83860686-83860708 GGAGCCCGAGTGGGCCCTGGCGG - Intergenic
910763922 1:90761888-90761910 GGCCCCTGAGGGTGCCCTAGGGG - Intergenic
911193480 1:94970971-94970993 GGGCCCCATGTCTGCCCTGGAGG - Intergenic
912548133 1:110465861-110465883 GGGGCCCCAGTGTCCCCTGGAGG + Intergenic
913072582 1:115314021-115314043 GGGTCCTGAGGGTGGCATGGTGG + Intronic
914678646 1:149923567-149923589 GGGCCTCGAGGGGGAACTGGTGG + Exonic
917920366 1:179744733-179744755 GGGCCCCCTGGGCGCCCTGGGGG - Intronic
917977646 1:180250698-180250720 GGGCCCTGAGGAAGCACTGGGGG - Intronic
919878784 1:201888990-201889012 GAGCCCCGCGGGTGGCATGGTGG - Exonic
919920783 1:202165347-202165369 GGTCCCCTAGGCTGCGCTGGGGG + Intergenic
922050972 1:221990404-221990426 GGCCCCTGAGGGAGCCCTGGTGG - Intergenic
922728234 1:227936007-227936029 GGGCTCTGAAGGTGCCATGGAGG - Intronic
923141466 1:231163748-231163770 GGGCCCGGAGGCTGCCTCGGCGG - Exonic
923623361 1:235595206-235595228 GGGCCCCGTGTCTGCCGTGGAGG + Intronic
924741643 1:246797569-246797591 GAGACCTGAGTGTGCCCTGGGGG - Intergenic
924810882 1:247400918-247400940 GTGCCCCGAGGGTGGTCTGGAGG + Intergenic
1064006398 10:11702659-11702681 TGGCCAGGAGGGTCCCCTGGAGG + Intergenic
1065325234 10:24544974-24544996 GGGCCCCGCTGGAGCCCTGTGGG - Exonic
1065689673 10:28320188-28320210 GGGCCGAGAAGGTACCCTGGAGG + Intronic
1067157167 10:43792076-43792098 GGGGCCCGAGTGTGCCCTGAAGG - Intergenic
1068920242 10:62475726-62475748 TGGCCCCGAGGGCACCATGGCGG + Intronic
1069635548 10:69922762-69922784 GGGGGCCCAGGGAGCCCTGGAGG - Exonic
1069703277 10:70441429-70441451 GCGCCCCGGGGGTGCCCAGCAGG + Intronic
1070733098 10:78845168-78845190 GGTCCCTGGCGGTGCCCTGGTGG - Intergenic
1070961863 10:80505189-80505211 ATGCCCCCAGGGTGCCCTGTGGG + Intronic
1071508364 10:86246308-86246330 GGGCCCTCAGGGAGCCCAGGTGG - Intronic
1073392917 10:103193660-103193682 GGGATTCGAGGGTGCCATGGGGG - Intergenic
1073510273 10:104038474-104038496 GGGGGCCCAGGGGGCCCTGGCGG + Exonic
1075092476 10:119451429-119451451 GGGGACCCAGGGTGCCCTAGGGG - Intronic
1076540053 10:131208019-131208041 TGGTCCCTAGGGTGCCTTGGTGG - Intronic
1076587525 10:131559694-131559716 GGGCCCCCAGGGTGGCCTCCCGG - Intergenic
1076826792 10:132973410-132973432 GGGAGCTGAGGCTGCCCTGGAGG + Intergenic
1076916031 10:133423526-133423548 GGGCCTCGAGGGTGCGCGTGAGG - Exonic
1076991786 11:279513-279535 CGGCCCGGAGCCTGCCCTGGAGG + Exonic
1077035517 11:492593-492615 GGGCCCCGAGGCAGACCCGGGGG - Intergenic
1077221723 11:1420918-1420940 GAGGGCCGAGGGGGCCCTGGGGG - Intronic
1077283049 11:1754170-1754192 GGGACTGGAGTGTGCCCTGGGGG + Intronic
1077326843 11:1967659-1967681 GGGCCCTGAGGGGACCCTGTGGG + Intronic
1077359601 11:2134836-2134858 GGGCCCCAAGGCTGCCGTGGGGG - Intronic
1078465026 11:11543778-11543800 GGGCCCCGAATGTGCCACGGTGG + Intronic
1079303052 11:19296612-19296634 GGGCCCTGAAGATGCCCTGGAGG + Intergenic
1080034565 11:27699248-27699270 GGGCTGCGAGGGTGAACTGGAGG - Intronic
1081528837 11:43944327-43944349 GGGACCCGAGAGTGGGCTGGAGG + Intronic
1081870990 11:46382385-46382407 GGGCCCCGCAGGTGCCCTCGCGG - Exonic
1082868399 11:57920507-57920529 GGGGCCTGAGGTGGCCCTGGAGG + Intergenic
1083554375 11:63614220-63614242 GGGCCCGGCGGGCGCCCAGGAGG + Exonic
1083626348 11:64073954-64073976 GAGCCCCCAGGGTGCTTTGGAGG + Intronic
1083883058 11:65557931-65557953 GGGCCCCGAGGGGCTGCTGGCGG - Exonic
1083995106 11:66267752-66267774 GGGCGGCGACGGTCCCCTGGTGG + Exonic
1084179391 11:67438889-67438911 CGGGCCCGAGGCAGCCCTGGAGG - Exonic
1084223315 11:67698299-67698321 GGGCCACCAGGGTGCCATGGTGG - Intergenic
1084430826 11:69110229-69110251 GGGCCAAGAGGTTGGCCTGGTGG + Intergenic
1084751657 11:71208188-71208210 GTGGCAGGAGGGTGCCCTGGAGG + Intronic
1084973050 11:72781739-72781761 GGGCCGCGCGGGGGCTCTGGTGG + Intronic
1085321435 11:75576468-75576490 GGGCCTGGAAGGTTCCCTGGGGG - Intergenic
1089460539 11:118650556-118650578 TGGCCCCCAGGGTGGCCTTGTGG - Intronic
1089687928 11:120168869-120168891 GGGCTCCGAGGGTGCGGCGGCGG - Intronic
1090409987 11:126501420-126501442 GGGGAGCGAGGGTGCCCAGGTGG + Intronic
1090768269 11:129895634-129895656 GGGCCTGGAGGGTGCCGGGGCGG + Intergenic
1091227678 11:133967391-133967413 GGGACCCGGGGGTGCCCCGGAGG - Intergenic
1091270393 11:134307348-134307370 AGGCCCTGAGGATGCTCTGGTGG + Intronic
1202809824 11_KI270721v1_random:22839-22861 GGGCCCTGAGGGGACCCTGTGGG + Intergenic
1091558704 12:1594495-1594517 GGGCGGCGAGGGGGCCCCGGGGG + Intronic
1091714371 12:2766633-2766655 GGGCCACCAGGGTTTCCTGGAGG - Intergenic
1091760485 12:3084160-3084182 GGGCCCCGTAGGGGTCCTGGTGG - Intronic
1091766433 12:3123042-3123064 GGCCCCACAGGGAGCCCTGGTGG + Intronic
1095261711 12:40105815-40105837 GGGGCCCGGGGCTGCCCGGGGGG + Exonic
1096073845 12:48789756-48789778 GGGCCCCGAGGTTCGCCTCGGGG - Intergenic
1096204287 12:49707708-49707730 GGGCGCCGAGCGCTCCCTGGCGG + Intronic
1096470399 12:51871923-51871945 GGGCCCCCAGGGTGGACGGGGGG + Intergenic
1096589969 12:52651697-52651719 GGGCCTGGAGGATACCCTGGTGG - Exonic
1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG + Exonic
1098290887 12:68956029-68956051 GGGCACTGTGGGTGCCGTGGAGG - Intronic
1101739971 12:107493157-107493179 GGGGACCGAGGGAGCACTGGGGG + Intronic
1102269140 12:111516233-111516255 TGGCCGCGAGGGGGGCCTGGAGG + Exonic
1103764790 12:123272041-123272063 GCGCCCCGGGGGTGTGCTGGGGG + Exonic
1103899193 12:124294869-124294891 GCGCACCGAGGGTGCCTTGTGGG - Intronic
1103972044 12:124678585-124678607 GGCCCCCGGGGGTGGCCTTGAGG + Intergenic
1105210128 13:18252688-18252710 AGGCCCCAAGGGAGGCCTGGAGG + Intergenic
1107553555 13:41498414-41498436 GGGCCCTGAGGCTGGCCTCGTGG - Intergenic
1107988401 13:45796084-45796106 GGGACCCGAGGGAGCCCCTGAGG + Intronic
1112050606 13:95641730-95641752 GGGCCCCGAAGCCGCGCTGGGGG + Exonic
1113669498 13:112166012-112166034 GGGCCCCGAGGATGCACCTGCGG + Intergenic
1113730435 13:112637500-112637522 GGGCCTGGAGGCCGCCCTGGCGG - Intergenic
1113958061 13:114109900-114109922 GCGCCCCAAGGGTGTTCTGGGGG - Intronic
1114269599 14:21092636-21092658 GGCTCCCGAGCGTCCCCTGGCGG - Exonic
1117315026 14:54565718-54565740 GGGACCCGAGGGCGCTCGGGCGG - Intergenic
1117627029 14:57650770-57650792 GGGCCATGAGGCTGACCTGGAGG - Intronic
1118316777 14:64730540-64730562 GGGGACAGAGGGTGCTCTGGGGG + Intronic
1119650056 14:76376992-76377014 GCGCCCCGAGGGTGCGCACGTGG + Intronic
1119742957 14:77026221-77026243 GGTCCCCGGGGGTGCGCTGGGGG + Exonic
1119743091 14:77026906-77026928 GGGCCCCCAGGAGCCCCTGGGGG + Exonic
1121781294 14:96624100-96624122 GGGCCACTGGGGTGCCCTCGAGG - Intergenic
1122132453 14:99612767-99612789 TGGCCCCCGGGTTGCCCTGGGGG + Intergenic
1122246755 14:100408504-100408526 GGGCACAGAGGGGGCGCTGGAGG - Intronic
1122352210 14:101102858-101102880 GGAGCCCCAGGGAGCCCTGGGGG + Intergenic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122625673 14:103084321-103084343 GGGCCCCGGGAGCGCCCTGACGG + Intergenic
1123006986 14:105328501-105328523 GGGCCCAGAGGCTGCTCTCGAGG + Intronic
1123209074 14:106741315-106741337 TGGCCCTGAGGGCTCCCTGGTGG + Intergenic
1124138656 15:27057628-27057650 GAGCCCCGAGGGTGACCTGGCGG - Intronic
1125200167 15:37095949-37095971 GGGACCCGGGAGTGCCCGGGAGG - Intronic
1127730562 15:61798090-61798112 GGGCCCTGAGGCAGCTCTGGAGG + Intergenic
1127905258 15:63371543-63371565 TGGCCTCGCGGGTGCCCTGTGGG + Intronic
1128067740 15:64775238-64775260 GGGCTCCGGCGGCGCCCTGGAGG - Exonic
1128145682 15:65331284-65331306 GGGCAGCCAGGGTGCCCGGGGGG + Intronic
1129220267 15:74128323-74128345 GTTCCCGGAGGCTGCCCTGGGGG - Exonic
1129230395 15:74194010-74194032 GGGCCCTGAGGGTGGTCTGGGGG + Intronic
1129412644 15:75358560-75358582 GGGCACCGAGGGCGGCCTGCGGG - Exonic
1132557255 16:578125-578147 GGGCCACGCGGATGCCCTGTGGG + Intronic
1132646548 16:1001909-1001931 GGACACCCAGGGTTCCCTGGAGG - Intergenic
1132678628 16:1130830-1130852 GGGGCCGGAGGGTGCAGTGGGGG + Intergenic
1132771592 16:1566728-1566750 GGGTCCCGGAGGTGCCATGGGGG - Intronic
1132884365 16:2176099-2176121 GGGCACCGTGTATGCCCTGGCGG + Exonic
1132959221 16:2612858-2612880 GGTGCCTGCGGGTGCCCTGGAGG - Intergenic
1132972281 16:2694833-2694855 GGTGCCTGCGGGTGCCCTGGAGG - Intronic
1133090666 16:3401409-3401431 GGGCCGCGGGGCCGCCCTGGAGG + Exonic
1133346107 16:5071702-5071724 TGGCCCCGAGGGGCTCCTGGGGG + Intronic
1133350503 16:5097842-5097864 GGGGCCCGGGGGTCCCCCGGGGG + Intergenic
1134243362 16:12522051-12522073 TGGCCCCGAGGGGCCCCTGCTGG + Intronic
1135864706 16:26090626-26090648 GGGCCCCGAGGGTCTCCAAGGGG - Intronic
1136483805 16:30558305-30558327 GGCCCCCGAGGGCGCACTAGAGG + Intronic
1138651278 16:58463115-58463137 GGAGCCCGAGGGTGTCCTTGAGG - Intronic
1139451267 16:67029522-67029544 GCGCCCCGAGTGGGCCCGGGCGG + Intronic
1139692681 16:68651096-68651118 GGTGCCCGAGGGAGCCCTGTTGG + Intronic
1139761458 16:69187452-69187474 GGGCCCCGAGGCGGCGCCGGCGG - Exonic
1141132184 16:81444464-81444486 CGCCCCCGCGGGTGCCCGGGCGG - Intergenic
1141965033 16:87436325-87436347 TGGGCCCGGAGGTGCCCTGGCGG - Intronic
1141997578 16:87645180-87645202 GGAACCCTAGGGTTCCCTGGAGG + Intronic
1142010047 16:87709325-87709347 GGTCGCTGAGGGTGACCTGGCGG + Exonic
1143034327 17:3985849-3985871 GGGGCCCGAGGGGGCCCTGAGGG - Intergenic
1143592374 17:7893471-7893493 GGGTCCGGAGGGTGCTATGGGGG - Exonic
1143652961 17:8275645-8275667 GAGAGCAGAGGGTGCCCTGGCGG - Intergenic
1143683139 17:8492383-8492405 GGCCCTCGAGGAAGCCCTGGAGG - Exonic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1144621079 17:16818890-16818912 GGGCCGTGAGAGTGCCATGGTGG + Intergenic
1144702707 17:17349347-17349369 GGACCCCGAGGGAGCTGTGGAGG + Intergenic
1145266371 17:21381417-21381439 GGGCCCTGAGGGTCCCAGGGAGG - Intronic
1145749028 17:27342026-27342048 TGGCCCTGAAGGGGCCCTGGGGG - Intergenic
1145887883 17:28395609-28395631 GGGCCCGGGGGGTGCTATGGGGG - Exonic
1146256076 17:31392082-31392104 GGGCCACGCGGGTGACCCGGCGG - Intronic
1146915059 17:36673103-36673125 GAGACCCCAGGGTGGCCTGGAGG + Intergenic
1147573056 17:41583182-41583204 GGGCCGTGAGAGTGCCATGGGGG + Intronic
1148156926 17:45429946-45429968 GGGCCCCGACGGCGCCCCCGAGG - Intronic
1148219539 17:45851815-45851837 GGGCCCTGGGGGTGGCCTTGAGG - Intergenic
1149773870 17:59342210-59342232 GGGCCCCAGCTGTGCCCTGGGGG + Intronic
1150373684 17:64662418-64662440 GCGCGCGCAGGGTGCCCTGGCGG + Intergenic
1151401369 17:73858003-73858025 GGGCAGCGAGGGGGCCCTGAGGG - Intergenic
1151801754 17:76383342-76383364 GGGACCCGAGAGTCCCCGGGCGG - Intronic
1152021529 17:77782254-77782276 GTGCCTCGTGGGTCCCCTGGGGG - Intergenic
1152110092 17:78353117-78353139 GGACACCGCGGGAGCCCTGGCGG - Intergenic
1152312374 17:79559017-79559039 GGGCTCCCAGGGTCTCCTGGTGG - Intergenic
1152345467 17:79748278-79748300 GGGCACCCAGGGTGCCCCGCAGG - Intergenic
1152545234 17:80997114-80997136 GGCCCTCGAGGGTGGCCTTGTGG - Intronic
1152722516 17:81929894-81929916 GGGGCGGGAGGGTGCCCGGGAGG - Intergenic
1152776290 17:82204069-82204091 GGGGCACGAGGGCTCCCTGGGGG + Intronic
1152786573 17:82251075-82251097 GGGCCCAGAGCATGCCCTGGGGG - Intronic
1152861781 17:82700678-82700700 TGACCCCGAGGGTGGGCTGGGGG - Intergenic
1152890087 17:82875516-82875538 GGGCCCCGTGGCTGCCTGGGCGG - Intronic
1152915221 17:83031244-83031266 GGGACCCGTGGGTGCTCTGGCGG - Intronic
1152915238 17:83031321-83031343 GGGACCCGTGGGTGCTCTGGCGG - Intronic
1152915255 17:83031398-83031420 GGGACCCGTGGGTGCTCTGGCGG - Intronic
1154078877 18:11234697-11234719 GGGGCCCCATGTTGCCCTGGTGG - Intergenic
1155928789 18:31685023-31685045 GGGGCCCGCGGGGGCCCTCGGGG + Intronic
1157770370 18:50340148-50340170 GGGCCGCGAGGCTCCCCTGAGGG - Intergenic
1158536169 18:58309872-58309894 GGGCTCAGAGGGAGTCCTGGTGG - Intronic
1158549638 18:58424497-58424519 GGCCCTGGAGGTTGCCCTGGAGG + Intergenic
1160531504 18:79567640-79567662 GGGCCCCCACGGTGCCCTTGAGG - Intergenic
1160694225 19:474764-474786 AGGCCCCGTGGGTGCTGTGGGGG - Exonic
1160733490 19:651582-651604 GGGCCCCGGGGGTGGCCGCGAGG - Intronic
1160828500 19:1091670-1091692 GGCCAGCCAGGGTGCCCTGGAGG - Intronic
1160980966 19:1816419-1816441 TGGCCCTGAAGGTGCCCTGCCGG - Exonic
1161222238 19:3123056-3123078 GGGGCCCGGCGGTGCCCTGGGGG + Exonic
1161242185 19:3228623-3228645 GGGCCCGGCGGGGGCCCGGGTGG + Intronic
1161411854 19:4122009-4122031 GGGCACCTAGGGTGCCAAGGTGG - Intronic
1162817783 19:13207099-13207121 GGGCGCCGTGGCTGCCCAGGAGG + Exonic
1162926282 19:13931941-13931963 GTGCCCCGAGGGTGACCGGAGGG - Intronic
1163361170 19:16847208-16847230 GGGACCCTAGTGTGGCCTGGAGG - Intronic
1163507997 19:17719635-17719657 GGGGCCCGCGGGAGCCCGGGAGG + Intronic
1165311361 19:35030891-35030913 GGGCACCGCGGGGGCACTGGCGG + Intronic
1165837851 19:38770392-38770414 CTGCCCCGAGGGTGCGCAGGCGG + Intergenic
1165841714 19:38792305-38792327 CTGCCCCGAGGGTGCGCAGGCGG - Intergenic
1166123962 19:40702722-40702744 GGGCCCCGAGCGCCCACTGGTGG + Intronic
1166731880 19:45064005-45064027 GGACTCCGAGGGTGACCTGCGGG - Exonic
1166792858 19:45408298-45408320 GGATCCTTAGGGTGCCCTGGGGG - Exonic
1167125332 19:47545121-47545143 CGGCCCCGGCGGTGGCCTGGAGG - Exonic
1167159209 19:47756406-47756428 GTGCCCACAGGCTGCCCTGGGGG + Intronic
1167320758 19:48796094-48796116 GAGGCCCCTGGGTGCCCTGGTGG - Intronic
1167567919 19:50268386-50268408 GGGTCTGGAGGGTGGCCTGGTGG - Intronic
1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG + Intronic
1167757561 19:51421955-51421977 AGACCCCGAGGGAGCCCAGGAGG + Intergenic
1168103406 19:54153011-54153033 GGGGCCCGAGGCTGCCCCGGGGG - Intronic
1168300365 19:55401536-55401558 GGGGCCCCAGGGGGCCCGGGAGG - Exonic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
1168352039 19:55681394-55681416 GGGCCCAGAGGGTGGGCTCGGGG - Intronic
925293442 2:2763155-2763177 GGGCCCTGAGGGGGCCCTCAAGG + Intergenic
926056772 2:9778322-9778344 GTGCCCCGAGTGTGCCCAAGTGG - Intergenic
926194972 2:10757887-10757909 GGGCACCGGGACTGCCCTGGAGG - Intronic
927710612 2:25323432-25323454 GGCCTCCCAGGGAGCCCTGGAGG - Intronic
927786842 2:25980644-25980666 GGGCCCTCAGGGTACCCAGGCGG + Exonic
929054304 2:37862837-37862859 GGGCCCTGAGGGAGCACTGGGGG - Intergenic
932219572 2:69989490-69989512 GGGCCCCAGGTGTGCCCAGGAGG + Intergenic
934516909 2:94993993-94994015 TGGCCCCAGGGATGCCCTGGGGG + Intergenic
935397061 2:102619926-102619948 GGGGCCCGTGGGCGCCCTGGCGG + Exonic
937285195 2:120746238-120746260 GGGTCCCAAGCCTGCCCTGGTGG + Intronic
937501140 2:122480566-122480588 GGGCCCCCAGGTTGCCTGGGAGG + Intergenic
941448908 2:165635182-165635204 GGGCCCCTGGGGTGCCCGTGAGG + Intronic
943571602 2:189581065-189581087 GCCCCCCGAGGTTGCCCTCGCGG - Intronic
944227228 2:197360034-197360056 GGGCCCCTAGGGGCCCCTGCTGG + Intergenic
946412508 2:219522378-219522400 GGGCCCGGAGGGTGGGGTGGGGG + Intronic
946621945 2:221571545-221571567 GCGCCCCGAGGGTGCGATTGCGG - Intronic
947168167 2:227283814-227283836 GGGTTCCCAGGGGGCCCTGGAGG - Exonic
947525188 2:230873307-230873329 GGGCCCGGAGGGAGTCTTGGGGG - Intronic
948597919 2:239092359-239092381 AGGCCCCGAGGCTGCCCCTGTGG + Intronic
948695100 2:239729357-239729379 CAGCTCCGAGGGTCCCCTGGGGG + Intergenic
1169196085 20:3682507-3682529 CTGCCCCGAGGGTGCCCTGGCGG + Intergenic
1171291276 20:23984378-23984400 AGGCCCTGAGGGAGGCCTGGAGG + Intergenic
1171349199 20:24490077-24490099 GGGCCCCAAAGGTATCCTGGAGG - Intronic
1172015287 20:31869650-31869672 GGGCCCCCCAGCTGCCCTGGGGG - Intronic
1172127883 20:32636039-32636061 GGACCCTGAGGGGGGCCTGGGGG - Intergenic
1175401240 20:58701172-58701194 TGGCTCTCAGGGTGCCCTGGGGG + Intronic
1175401321 20:58701355-58701377 GGCTCTCCAGGGTGCCCTGGGGG + Intronic
1175896085 20:62336106-62336128 GGGCTGCGAGTGTGCCCTGAGGG - Intronic
1175954159 20:62599749-62599771 GTGCCCTGAAGGTGTCCTGGTGG - Intergenic
1176427989 21:6560503-6560525 GGAGCCCCAGGGTGCCCAGGCGG + Intergenic
1179703480 21:43168820-43168842 GGAGCCCCAGGGTGCCCAGGCGG + Intergenic
1179801522 21:43813520-43813542 GTGCCCTGAGGGTGACATGGGGG - Intergenic
1179949738 21:44703011-44703033 GGGCCCCGGGTGTTCCCTGGTGG + Intronic
1180161129 21:45999200-45999222 GGGTCCCGAGGGCCCCCAGGTGG + Exonic
1180180782 21:46117873-46117895 GGGCCCCGACGGTTACCCGGGGG + Exonic
1180766129 22:18346716-18346738 AGGCCCCGAGGGAGGCCTGGAGG - Intergenic
1180780184 22:18515662-18515684 AGGCCCCGAGGGAGGCCTGGAGG + Intergenic
1180812900 22:18772983-18773005 AGGCCCCGAGGGAGGCCTGGAGG + Intergenic
1181199078 22:21207299-21207321 AGGCCCCGAGGGAGGCCTGGAGG + Intergenic
1181264908 22:21625291-21625313 GGGCCCCTAGGGAACCCTGGAGG + Intergenic
1181277171 22:21694481-21694503 GAGCCCCGAGGCTGGCCTGGTGG - Intronic
1181400684 22:22648557-22648579 AGGCCCCGAGGGAGGCCTGGAGG - Intergenic
1181558898 22:23688355-23688377 GGGGCCTGAGGCTGCCCTGATGG - Intronic
1181568279 22:23752553-23752575 GAGCCCCCAGGGGGCCATGGTGG + Intergenic
1181648706 22:24247331-24247353 AGGCCCCGAGGGAGGCCTGGAGG + Intergenic
1181702664 22:24629655-24629677 AGGCCCTGAGGGAGGCCTGGAGG - Intergenic
1182664210 22:31945114-31945136 GGGGGCAGAGGGTGCCCTAGGGG + Intronic
1183075311 22:35423071-35423093 GGGCACCGAGTGTGCCAGGGTGG - Intronic
1183300811 22:37058246-37058268 GAGCCCCCAGGATGGCCTGGAGG + Intronic
1183724377 22:39580416-39580438 GGTACCTGAGGTTGCCCTGGGGG - Intronic
1184062328 22:42091008-42091030 GCGGCCCGAGCGTCCCCTGGCGG - Intergenic
1184691875 22:46121102-46121124 GGGTCCCCAGGGTCCCCTGGGGG - Intergenic
1185059821 22:48600417-48600439 GGGGCCCGAGGCAGCCCTTGTGG + Intronic
1185179452 22:49350646-49350668 GGTGCCGCAGGGTGCCCTGGAGG - Intergenic
1203227747 22_KI270731v1_random:87607-87629 AGGCCCCGAGGGAGGCCTGGAGG - Intergenic
950665384 3:14492054-14492076 GGTCCCCAAGGGGGCCTTGGTGG + Exonic
953344046 3:42160245-42160267 GGGCGCAGTGTGTGCCCTGGGGG + Intronic
953910473 3:46890225-46890247 GGGGCCCCAGGGTGGACTGGGGG - Intronic
954109167 3:48424657-48424679 GTGGCCCCAGGGTGCTCTGGCGG - Intronic
954196318 3:48999198-48999220 GGGCCCTGAGGGAGCCCTCCAGG + Intronic
960874592 3:122284249-122284271 GGGCCATGAGGGAGCCCTCGTGG - Exonic
961336043 3:126180344-126180366 GGGCCCCGCAGGAGCCCTTGCGG + Intronic
961745312 3:129060689-129060711 AGGCCCCAAGGCTGCACTGGGGG + Intergenic
961772577 3:129260818-129260840 GGGGGCCGTGGGTGTCCTGGGGG - Intronic
962919012 3:139934959-139934981 GGGCCCCCAGAGGACCCTGGTGG - Intergenic
963776987 3:149449839-149449861 GGGCCCAGAGGCTTCTCTGGGGG - Intergenic
964282387 3:155080251-155080273 GGGCCCAGAGGGTGACCTGGAGG + Intronic
964852107 3:161105593-161105615 TGGCCTCGAGGCGGCCCTGGAGG + Intronic
965701416 3:171462275-171462297 GGGCCACGAGGGTGCCAAGTTGG + Intergenic
966928863 3:184662903-184662925 GGGGCCCGACGGTGTGCTGGGGG + Intronic
968137028 3:196227124-196227146 GGCCCCCGGGGCTGCCCTGTGGG + Intronic
968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG + Intergenic
968626789 4:1629438-1629460 GGGCCTCGACTGTGCCCTGGAGG + Intronic
968653845 4:1770354-1770376 GGGCCCCGCGGCAGCCCGGGCGG + Intergenic
969347060 4:6576235-6576257 GGGCCCTGAGTGTGCCATTGAGG - Intronic
974603792 4:64122822-64122844 GGGCACCGAAGCTGCCCTGCAGG + Intergenic
984734966 4:183099720-183099742 GTGCCCCGAGGGGTCCCGGGAGG + Intronic
985831708 5:2238787-2238809 GGGTCCTGAGAGTGCGCTGGAGG - Intergenic
986754650 5:10824094-10824116 GGCAACCTAGGGTGCCCTGGGGG - Intergenic
992789581 5:80201437-80201459 GGGCACTGATGGTGCCCTGCTGG + Intronic
997340697 5:133142349-133142371 GGGCTCCAAGGATGCCCAGGAGG - Intergenic
997723203 5:136097425-136097447 GGGCCCAGAGGGAGCACTGATGG + Intergenic
998217522 5:140248497-140248519 GGGTCCACAGGGTGCCCAGGTGG - Intronic
998279196 5:140788351-140788373 GGGCCCAGAGGCGGCGCTGGTGG + Exonic
998280624 5:140803258-140803280 GGGCCCGGAAGCTGCACTGGTGG + Exonic
998281245 5:140809248-140809270 GGGTCCCGATGCTGCGCTGGTGG + Exonic
998282388 5:140823833-140823855 GGGTCCCGAGGCTGCCCTGGTGG + Exonic
998283009 5:140830152-140830174 GGGCCCAGAGGCGGCGCTGGTGG + Exonic
998284994 5:140850556-140850578 GGGCCCCGAGGTGACGCTGGTGG + Exonic
998285686 5:140858103-140858125 GGCGCCCGAGGTGGCCCTGGTGG + Exonic
998286910 5:140871161-140871183 GAGCCCAGAGGCTGCGCTGGTGG + Exonic
999098878 5:149005779-149005801 CTGCCCTGAGGGTTCCCTGGGGG + Intronic
1000111002 5:158107997-158108019 TGGCCCCCAGGGTGGCCTGGAGG + Intergenic
1000197371 5:158972728-158972750 GGGCCCCGTGGGCGCTATGGAGG - Intronic
1001773281 5:174311513-174311535 GGTTCCCAGGGGTGCCCTGGGGG - Intergenic
1001823042 5:174724746-174724768 GGGCGCCGAGGGGGCCGCGGAGG + Exonic
1002043158 5:176528746-176528768 GGGACCTGAGGGTGCACAGGAGG + Exonic
1002642808 5:180638484-180638506 GGGCCCAGAGGCAGGCCTGGAGG - Intronic
1003058010 6:2840818-2840840 GGGCACCCAGGGTGCCCTAAAGG + Intronic
1003868351 6:10382883-10382905 GGGCGCCGGGGGTGCCCTGGCGG + Intergenic
1005947146 6:30602893-30602915 GGGCCCCCAGGACCCCCTGGTGG + Exonic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1012543750 6:100393587-100393609 AGGCCGGGAGGGAGCCCTGGTGG - Exonic
1013787003 6:113793061-113793083 GAGCCCTGAGGGTGCAATGGTGG - Intergenic
1014272241 6:119348711-119348733 GGACCCGGAGGCCGCCCTGGAGG - Exonic
1014550941 6:122789321-122789343 GGGCCGCGGGGCTGACCTGGAGG - Exonic
1015904875 6:138107075-138107097 CGGCCCCGAGGGCTTCCTGGAGG + Intronic
1015965518 6:138692864-138692886 GGGCGCCGAGGGAAGCCTGGCGG + Intergenic
1016329884 6:142945194-142945216 GGGCCGCGCGGGAGCGCTGGAGG - Exonic
1016657954 6:146543405-146543427 GGGCCCCGGAGGTTCACTGGGGG - Intergenic
1017805556 6:157942579-157942601 GGGGCCCGAGCTGGCCCTGGTGG - Intronic
1018733780 6:166672485-166672507 GGGCTCTGTGGGTGCCATGGAGG + Intronic
1018848458 6:167571271-167571293 AGGCCCCAGGGGTGCCCTGTTGG - Intergenic
1019414412 7:920707-920729 GGGCTCAGTGGGTGCCGTGGGGG - Intronic
1019429230 7:991041-991063 GGGGCCCGAGGGTCCCCTGCAGG - Intergenic
1019597356 7:1864315-1864337 GGGCCCCGGGTCTGCCCTGCAGG - Intronic
1019726488 7:2605788-2605810 TGACGCCCAGGGTGCCCTGGGGG + Intronic
1020137394 7:5594606-5594628 GGGTCCCGAGGTTCCCCAGGAGG + Intronic
1022093364 7:27122727-27122749 GGGCGCCAAGGTGGCCCTGGGGG + Intronic
1022113895 7:27246666-27246688 GGGTCCGGAGGCTGCCCCGGAGG - Intronic
1023871690 7:44266715-44266737 GTGCCCCGCGGGGGTCCTGGGGG - Intronic
1024059609 7:45687951-45687973 CAGCCCAGAGGGTGCCCAGGAGG + Intronic
1024370905 7:48582649-48582671 GGGCTCTGAGGGTCCCCGGGAGG - Intronic
1024669906 7:51585014-51585036 TGGCCCAGTGGGTGCCCTGTAGG - Intergenic
1024961382 7:54980688-54980710 GGCGCCCGAGGGCGTCCTGGGGG - Intergenic
1025991866 7:66503272-66503294 GGGGCCCGGAGGTGCCCTGGGGG - Intergenic
1026152814 7:67802616-67802638 AGACCCAGAGGGTACCCTGGCGG + Intergenic
1026935785 7:74254510-74254532 GGGTTCCGGTGGTGCCCTGGCGG + Intergenic
1029425101 7:100489839-100489861 GGTCCCCCAGTGTGCGCTGGAGG + Intronic
1029640160 7:101815650-101815672 CGGCCCCGAGGGGGCGCTGGAGG - Intergenic
1032164162 7:129532770-129532792 GGGCCCCTAGGTTGCTGTGGTGG + Intergenic
1032391369 7:131556963-131556985 GGGCCCCGGCGGTGTGCTGGGGG - Intronic
1034264858 7:149776009-149776031 GTTCCCCAAAGGTGCCCTGGGGG + Intergenic
1034269641 7:149797361-149797383 GGGCCCAGAGGGTGGAGTGGGGG + Intergenic
1034343543 7:150372319-150372341 GGGTCCTGCGGGTGCTCTGGCGG - Exonic
1035004482 7:155644861-155644883 GGGCCCCGCGAGTGCCATGGCGG + Exonic
1035283843 7:157794005-157794027 GAGGCCCGAAGGTGGCCTGGAGG - Intronic
1036791945 8:11726798-11726820 GGGCCCTGATGGTGCCCTCCTGG + Intronic
1037906601 8:22719204-22719226 GGGCCCTGAGGCTGCCCTGGAGG + Intronic
1039805579 8:40994716-40994738 TGGCCCCGAGACAGCCCTGGTGG + Intergenic
1040391529 8:46954766-46954788 GGACCCCGCGGGTGCTCCGGGGG - Intergenic
1040550114 8:48431114-48431136 TGGCACAGAGGGTGCTCTGGTGG + Intergenic
1041107876 8:54459251-54459273 GGGCCCCGAGGGCGGCCGCGTGG + Exonic
1042546221 8:69953967-69953989 GGGCCCCGCGGGGGTCCTGCTGG - Intergenic
1042640284 8:70926595-70926617 GGGCCCAGAGTGTGACATGGAGG + Intergenic
1044525184 8:93242859-93242881 GGGCCCCAAGGCAGTCCTGGTGG - Intergenic
1048178340 8:132172678-132172700 CGGACCCCAGGATGCCCTGGAGG + Exonic
1049156047 8:141067402-141067424 GGGCCCTGAGGGGTCACTGGGGG + Intergenic
1049288982 8:141791649-141791671 GGGCCCCGAAGGCCCCCAGGGGG - Intergenic
1049476953 8:142801288-142801310 GGACCCAGAGGCTCCCCTGGAGG - Intergenic
1049479808 8:142816539-142816561 GGACCCCGAGGGTGCACTGCCGG - Intergenic
1049588112 8:143441203-143441225 GGGCCCCGTGGGTACTCGGGGGG - Intronic
1049772579 8:144390623-144390645 GGGCCCCGAGCCTGCCCCGCTGG + Intronic
1049799375 8:144510673-144510695 TGGCCCCCAGGGTGTCCAGGTGG - Exonic
1050328869 9:4524934-4524956 GGGCCCAGTGGGAGCCCTTGGGG - Intronic
1050430954 9:5560903-5560925 GGGGCTCGAGGGTGACCTGCTGG + Intronic
1051398410 9:16652936-16652958 GGGCCCACAGGGTGCCCTTGAGG - Intronic
1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG + Intronic
1056830309 9:89911832-89911854 GGGAGCTGAGGGTGCCATGGAGG + Intergenic
1057220511 9:93255294-93255316 GGGCTGCCAGGCTGCCCTGGAGG + Intronic
1057303932 9:93901818-93901840 CGCCCCCCAGTGTGCCCTGGGGG + Intergenic
1057489281 9:95508892-95508914 GGGGTCCGAGGGTGCCCGGCGGG + Intronic
1057722774 9:97546225-97546247 GGGGCCCGTGGGCGCCTTGGTGG - Exonic
1059119782 9:111631506-111631528 GCGGCCCGCGGGGGCCCTGGTGG + Exonic
1060525990 9:124321679-124321701 GGGCGCCCAGGGTCCCCGGGTGG - Intronic
1060940428 9:127540248-127540270 GAGGCCCCAGGGTGGCCTGGAGG + Intronic
1061042840 9:128149798-128149820 GTGCCACCAGGGTCCCCTGGTGG + Intronic
1062179564 9:135184032-135184054 GGGACCCGAGGGGTCCTTGGAGG + Intergenic
1062181111 9:135191779-135191801 AGTGCCCGAGGGTGACCTGGGGG + Intergenic
1062254633 9:135615154-135615176 GAGCCCAGAGGGTGGCCTGCTGG + Intergenic
1062316046 9:135967408-135967430 TGGCCCTGAGAGTTCCCTGGAGG + Intergenic
1062324715 9:136006424-136006446 GGGTCCTGAGGGTGCCCCTGGGG + Intergenic
1062410854 9:136423559-136423581 GGGCCCCGCAGGTTCCTTGGAGG + Exonic
1062580567 9:137227559-137227581 GGCCTCCCAGGGTGGCCTGGAGG + Exonic
1062708894 9:137960747-137960769 GGGACCCCAGGCCGCCCTGGTGG + Intronic
1203758950 EBV:2035-2057 GGGCACGGAGAGTGCCCTGGAGG + Intergenic
1185504880 X:624566-624588 AGGCCCCGAGCGCGCCCCGGAGG - Exonic
1187859562 X:23667901-23667923 GGGCCCGGAGGCAGCCCAGGGGG - Intronic
1188003499 X:25002574-25002596 GGGCTCCGCGCGCGCCCTGGAGG - Intergenic
1200073872 X:153541877-153541899 GGTCCCCGTGGCTGCGCTGGTGG + Exonic
1200074525 X:153544539-153544561 GAACCCTGAGGGGGCCCTGGAGG + Intronic
1200951825 Y:8905197-8905219 GGGCCCCGAGGGCCACGTGGTGG + Intergenic
1202161133 Y:21938130-21938152 GGGCCCCGAGGGGCACGTGGTGG - Intergenic
1202230223 Y:22648243-22648265 GGGCCCCGAGGGGCACGTGGTGG + Intergenic
1202312933 Y:23547922-23547944 GGGCCCCGAGGGGCACGTGGTGG - Intergenic
1202557869 Y:26122672-26122694 GGGCCCCGAGGGGCACGTGGTGG + Intergenic