ID: 1053052880

View in Genome Browser
Species Human (GRCh38)
Location 9:34976450-34976472
Sequence GGGCCCCGAGGGTGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053052868_1053052880 22 Left 1053052868 9:34976405-34976427 CCCTGGCCATGGGAGGCAGAGAC 0: 1
1: 0
2: 2
3: 85
4: 568
Right 1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 341
1053052869_1053052880 21 Left 1053052869 9:34976406-34976428 CCTGGCCATGGGAGGCAGAGACT 0: 1
1: 0
2: 2
3: 48
4: 582
Right 1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 341
1053052870_1053052880 16 Left 1053052870 9:34976411-34976433 CCATGGGAGGCAGAGACTTAGCA 0: 1
1: 0
2: 1
3: 19
4: 283
Right 1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053052880 Original CRISPR GGGCCCCGAGGGTGCCCTGG AGG Intronic