ID: 1053052952

View in Genome Browser
Species Human (GRCh38)
Location 9:34976756-34976778
Sequence GGCAAATGTTCCTGGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053052937_1053052952 24 Left 1053052937 9:34976709-34976731 CCCTCCTGCTTCTGCAGCAGTTG 0: 1
1: 0
2: 5
3: 37
4: 360
Right 1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG 0: 1
1: 0
2: 0
3: 15
4: 142
1053052947_1053052952 -3 Left 1053052947 9:34976736-34976758 CCCAGGTGAGGGCCAGTTGGGGC 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG 0: 1
1: 0
2: 0
3: 15
4: 142
1053052939_1053052952 20 Left 1053052939 9:34976713-34976735 CCTGCTTCTGCAGCAGTTGCGTC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG 0: 1
1: 0
2: 0
3: 15
4: 142
1053052938_1053052952 23 Left 1053052938 9:34976710-34976732 CCTCCTGCTTCTGCAGCAGTTGC 0: 1
1: 0
2: 0
3: 43
4: 393
Right 1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG 0: 1
1: 0
2: 0
3: 15
4: 142
1053052948_1053052952 -4 Left 1053052948 9:34976737-34976759 CCAGGTGAGGGCCAGTTGGGGCA 0: 1
1: 0
2: 2
3: 26
4: 175
Right 1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG 0: 1
1: 0
2: 0
3: 15
4: 142
1053052945_1053052952 -2 Left 1053052945 9:34976735-34976757 CCCCAGGTGAGGGCCAGTTGGGG 0: 1
1: 0
2: 4
3: 16
4: 212
Right 1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG 0: 1
1: 0
2: 0
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053052952 Original CRISPR GGCAAATGTTCCTGGGATAC TGG Intronic
902892600 1:19455172-19455194 GGCAAGGGTTCCTGGGTTAAGGG + Intronic
908690590 1:66775099-66775121 GGCTAATATTCCTGGGATGCAGG + Intronic
908934284 1:69355975-69355997 TGCAAAAATTCCTAGGATACAGG + Intergenic
912778095 1:112519334-112519356 TCCAAATGTCACTGGGATACGGG - Intronic
913992720 1:143629543-143629565 GGGACATGAGCCTGGGATACAGG - Intergenic
914394580 1:147252836-147252858 CACAAATGTCCCTGGGATCCAGG + Intronic
915471053 1:156126120-156126142 GGGCGATGTTCCTGGGAGACAGG + Intronic
916247635 1:162704920-162704942 GGCAAATCTTCAGGGGATTCTGG - Intronic
918695360 1:187540112-187540134 TGGAATTGTTCCTGGGATATAGG - Intergenic
921120827 1:212135535-212135557 AGCAAATGTTCTCTGGATACTGG - Intergenic
923291580 1:232551376-232551398 AGCCAATGTTCCTTAGATACTGG - Intronic
924136048 1:240968036-240968058 GCCAAGTCTTCCTGGGATATTGG - Intronic
1067284384 10:44896888-44896910 GGCCACTCTTCCTGAGATACAGG - Intergenic
1067661794 10:48241548-48241570 GGGAAATGTTCCTGGGAGAGGGG - Intronic
1069549866 10:69355897-69355919 AGCAAATGGTGCTGGGACACTGG + Intronic
1072151072 10:92684462-92684484 GGCACATGTTCTTGGGAAAATGG - Intergenic
1075572685 10:123557233-123557255 GGCAAATGTTGGGAGGATACTGG - Intergenic
1075846060 10:125545819-125545841 AGGAAATGCTCCTGGGACACAGG + Intergenic
1076587921 10:131561930-131561952 GGAATCTGTTCCTGGGATTCAGG - Intergenic
1078665457 11:13321328-13321350 GGCACATGTGCTTGGTATACAGG - Intronic
1079195401 11:18322407-18322429 GGCGAAGGGTCCTGGGATCCTGG - Intronic
1080726977 11:34907988-34908010 GGCATATATTCCTCAGATACAGG + Intronic
1084068625 11:66719808-66719830 GGAAAATGTTCCTGGCACTCTGG - Intronic
1089235217 11:117018603-117018625 GGCAAATGTTGCTGGGAAGGAGG + Intronic
1089702955 11:120256474-120256496 GGCAAGTCTTCCTGGAAAACAGG - Intronic
1090828246 11:130402891-130402913 GGAATATGTTCCTGGGAGAGGGG + Intergenic
1091810386 12:3392066-3392088 GACAAATGTTTCTGGTATGCAGG + Intronic
1093798383 12:23341297-23341319 ACCAAATGTTCCTGGGATTCAGG - Intergenic
1094219514 12:27976407-27976429 GTCCAATTTTCCTGAGATACCGG - Intergenic
1098160644 12:67645811-67645833 TGTAAATGTTTCTGGGATAAGGG + Intergenic
1099541368 12:83912541-83912563 GTTAAATGTTCCTGGGATTCTGG + Intergenic
1101869575 12:108553873-108553895 GCAAATTGTTCCTAGGATACTGG - Intronic
1103822025 12:123706487-123706509 GGCAGATGTTGCTGGGCGACAGG + Intronic
1106158393 13:27178564-27178586 GTTAATTGTTCCTGGGAAACAGG + Intergenic
1106346518 13:28884860-28884882 CACAAATTTTCCTGGTATACAGG + Intronic
1109132533 13:58605712-58605734 GCCAGGTGTTCCTGGCATACTGG - Intergenic
1112593116 13:100782632-100782654 TCCAAAGGTGCCTGGGATACTGG - Intergenic
1115516229 14:34187871-34187893 TGCAAATGTTGCTGCGATAGTGG + Intronic
1116169000 14:41374143-41374165 GGCACAAGTACCTGTGATACAGG - Intergenic
1119853719 14:77884146-77884168 AGCACATGTTCCTGGGAGTCAGG + Intronic
1202841533 14_GL000009v2_random:125705-125727 GGCAAATGTTCATCAGACACTGG - Intergenic
1202910921 14_GL000194v1_random:115937-115959 GGCAAATGTTCATCAGACACTGG - Intergenic
1123858973 15:24443913-24443935 AGCAAATGTTGCTGGGAGAAAGG - Intergenic
1124707109 15:31975268-31975290 GGCAAGGTTTCCTGGGTTACTGG - Intergenic
1129646955 15:77444665-77444687 GAGAAATGTTCCTAGGAAACTGG + Intronic
1137641588 16:50035859-50035881 AGCAGATGTTCCTGAAATACTGG - Exonic
1137995006 16:53200683-53200705 GGCAAATGTATATGGGAAACAGG + Intronic
1138651973 16:58465795-58465817 GGAAGCTGTTCCTGGGACACTGG + Intronic
1141046547 16:80720651-80720673 GGCATTTCTTCCTGGGATTCAGG + Intronic
1141623683 16:85250261-85250283 GGCAAAGGGTCCTGGGTTCCCGG + Intergenic
1142204951 16:88778516-88778538 GGCAAAGGTTCCTGAGACAACGG + Intronic
1143103317 17:4515665-4515687 GGCACAGGTGCCTGGGACACAGG - Intronic
1144088852 17:11835279-11835301 GCAAAATGGTCCTGGGTTACTGG - Intronic
1145072784 17:19825235-19825257 GGCAAGTGTTTCTGTTATACAGG - Intronic
1148138235 17:45309537-45309559 GGCAAATGTTCCTGAGTGAAAGG + Intronic
1148770293 17:50062528-50062550 GGGAAGTGTTCCTGGGAGAAGGG - Intronic
1152835087 17:82524725-82524747 CGCAGGTGTTCCTGGGAGACTGG + Intronic
1152883556 17:82834312-82834334 AGCAACTGTGCCTGGGAGACAGG + Intronic
1157203160 18:45676537-45676559 GCCAAATGTTCCTGGGGAAGGGG - Intronic
1157590909 18:48836034-48836056 AGCAAATGTTCATGGGCTAGAGG - Intronic
1157714042 18:49870209-49870231 GTCAAATGGTGCTGGGAAACCGG + Intronic
1158896735 18:61921302-61921324 GGGAGCTGTTCCCGGGATACCGG + Intergenic
1159672389 18:71237584-71237606 GGCAAATGTTCCTGAAATCTGGG - Intergenic
1164589594 19:29499399-29499421 GGCAATTGGTCCTGGGAGAACGG - Intergenic
1165347865 19:35260099-35260121 GGCAGAGGTTCCTGGGTCACTGG - Intronic
1166718532 19:44984516-44984538 GGCATGGGTTCCTGGGACACGGG + Intronic
1166910185 19:46148931-46148953 GGCAATAGTGCCTGGGCTACAGG - Exonic
925192440 2:1895605-1895627 GGGAAATGGTACTGGGATAATGG + Intronic
925796158 2:7545037-7545059 GAAAAATGTTCATGGGATAGAGG - Intergenic
925850185 2:8073605-8073627 GGCAGATGTTTGTGAGATACTGG - Intergenic
926632243 2:15147149-15147171 GGGAAATGTCCCTGGGAGGCAGG + Intergenic
926841134 2:17081649-17081671 GCCAAATCTCCCTAGGATACAGG - Intergenic
926971454 2:18471360-18471382 GGGAAGGGTTGCTGGGATACTGG + Intergenic
927338652 2:21954402-21954424 GGCAAATTATCCTGGCATCCTGG + Intergenic
929888617 2:45900832-45900854 GGCATATGATTTTGGGATACAGG + Intronic
930257500 2:49109047-49109069 AGCAAATCTGCCTGGGATTCTGG + Intronic
932463022 2:71895629-71895651 GGCAAGTTTTCCTGGGAGACAGG - Intergenic
933716975 2:85368821-85368843 GGCAAATGTTTCTGTGAGTCTGG + Intronic
934707680 2:96496175-96496197 GGCAAATGTCCCAGGGATAGGGG + Intergenic
937909863 2:127070237-127070259 GGCAAATGTTCCTGCCCTATTGG + Intronic
938208344 2:129442697-129442719 GGCAAAAGTTCCTTGGGTAGAGG + Intergenic
1169155620 20:3327349-3327371 GCCAAATGTTCCTGGGAGTGGGG + Intronic
1169191874 20:3663090-3663112 GGCAAAAGTTCCTGGGGCACGGG + Intronic
1169473297 20:5907425-5907447 GGCTAATGTTTCTGGGCTCCGGG + Intergenic
1172754952 20:37277006-37277028 GCCATATGTTGCTGGGATTCTGG + Intergenic
1173533995 20:43794941-43794963 GGGAAATGGTCCTGGGAAAGAGG - Intergenic
1176630273 21:9130634-9130656 GGCAAATGTTCATCAGACACTGG - Intergenic
1177819809 21:26018625-26018647 GGCAAGTCTTCCTGGGAAAGGGG - Intronic
1177972825 21:27811289-27811311 GGCAAATGTTCTTGGTATGTGGG + Intergenic
1178007655 21:28241031-28241053 GCCCAATGCTCCTGGTATACAGG - Intergenic
955459656 3:59167813-59167835 GGCAAATATTTCTGGGACAGGGG - Intergenic
957716781 3:83938343-83938365 GGCAAATATTCCTGAGGGACTGG - Intergenic
957809393 3:85199577-85199599 GGCAAATGTTTCTTGAATGCAGG + Intronic
958115455 3:89210469-89210491 GGCAAGTGTTCCTGCAATGCTGG + Exonic
964532465 3:157683392-157683414 GACAAATGTTGGTGGGATGCTGG - Intergenic
967488660 3:190063352-190063374 AGCAAATGTTCTTGGGAAAAAGG + Intronic
967808561 3:193736262-193736284 GGCAAGTGTTCCTGGAAGAGGGG + Intergenic
968190115 3:196661188-196661210 GGCCCATGTTCCTGAGAGACAGG - Exonic
973822761 4:54677275-54677297 GGCAAATGCTCCTGGGACGAGGG - Intronic
973863902 4:55092867-55092889 GGCTAATGATACTGGGATTCAGG - Intronic
974059574 4:57019272-57019294 AGCAAATGTTCCTTTGGTACTGG + Intronic
980863008 4:138521799-138521821 GGGAAATCTCCCTGGGGTACAGG + Intergenic
982106193 4:152014049-152014071 GGCAACTCTTCCTGGGACACAGG - Intergenic
986352190 5:6891056-6891078 GGCACATGATCCTGGGAACCAGG - Intergenic
986396201 5:7333282-7333304 GGCGAATTTTCCTGGGACACAGG - Intergenic
987166161 5:15200812-15200834 GGCCAATGTTTCTGGGTTTCTGG + Intergenic
990335635 5:54769590-54769612 TGCACATGTTCCAGGGATAGGGG - Intergenic
992124895 5:73629754-73629776 GGCATTTGTTCCAGTGATACTGG + Intronic
994923915 5:106088868-106088890 TGCAAACTTTCCTGGGTTACAGG + Intergenic
996523167 5:124449616-124449638 GGCAAATGTTCCTGGGACTATGG - Intergenic
997940912 5:138156537-138156559 GACAAATGTTCCTGAGGTAAGGG + Intronic
1000960709 5:167597517-167597539 GTAAAATTTTCCTTGGATACTGG + Intronic
1001596971 5:172904752-172904774 GGCAAATGTTCCAGGGCTGCTGG - Intronic
1002629285 5:180559054-180559076 GGCATATGTTTCTTGGGTACTGG + Intronic
1003300557 6:4877547-4877569 GAAAAATGTAGCTGGGATACTGG - Intronic
1009883204 6:69595202-69595224 AGCAATTGTTCCTGGGATGGTGG - Intergenic
1010919956 6:81668956-81668978 AGAAAATGTCCCTGGGTTACTGG + Intronic
1011295721 6:85825185-85825207 TGCACATGGTCCTGGGATCCTGG - Intergenic
1016423123 6:143905882-143905904 GAGATTTGTTCCTGGGATACAGG - Intronic
1018129884 6:160718808-160718830 GCCAATTGTTCCGTGGATACTGG - Exonic
1019051082 6:169184576-169184598 GGCAAATGCTCCCTGGAAACAGG + Intergenic
1022395856 7:29987951-29987973 GGCAAATGCTTCAGGGATAATGG - Intronic
1022480589 7:30740819-30740841 GGCAAATGTGCCTGGGGTGCTGG + Intronic
1024192862 7:47030638-47030660 AGCAAATGTCCCTGGGATGTAGG - Intergenic
1024469346 7:49751103-49751125 GGCAAAAGATCCTGGGAGACTGG + Intergenic
1026622175 7:71959454-71959476 GGTAGATGTTCCTGGGAGAAGGG - Intronic
1028628375 7:92904321-92904343 GCCAAATGTTCCTGGAAAATGGG + Intergenic
1029051802 7:97697470-97697492 GGCAAATGTTGGAGGGAGACAGG - Intergenic
1029506179 7:100965392-100965414 GGCAAATGTCCCTGGTAGCCCGG - Intronic
1030304519 7:108004415-108004437 GGCAAATGTGGCTGGAATTCAGG + Intergenic
1033511033 7:142060422-142060444 GGCAGCTGTTCCTGGGATTGTGG + Intronic
1033880762 7:145880602-145880624 TGCTAATTTTCCTGGGATAATGG + Intergenic
1034555004 7:151844939-151844961 GGCAAACCTCCCTGGGACACGGG + Intronic
1036600634 8:10257302-10257324 GTCAAATGTTCCGGGGGTAAGGG - Intronic
1036676311 8:10836853-10836875 GGGAAATGTTCCAGGGAAGCAGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041539808 8:58970908-58970930 AGCTAATTTTCCAGGGATACTGG + Intronic
1043062511 8:75522694-75522716 GTCAAATGTTCCTGGGGAGCAGG + Intronic
1045582481 8:103497226-103497248 GTCATATGTTCCAGTGATACTGG + Intergenic
1047549624 8:125855959-125855981 GGCAAATGTGCCTGGTTTTCAGG + Intergenic
1048347655 8:133589211-133589233 CACATATGTTCCTGGGATAAAGG - Intergenic
1049970760 9:820229-820251 GGCAAATGTTCCAGGCAGAGAGG - Intergenic
1052025109 9:23565515-23565537 GGCAAAAGTTCCTGAGACACTGG - Intergenic
1052329205 9:27250467-27250489 GGCTTATGTTACTGGGAGACAGG - Intergenic
1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG + Intronic
1057002636 9:91526594-91526616 AACAAATGGTCCTGGGAAACTGG + Intergenic
1061011523 9:127958102-127958124 AACAAATGTTTCTGGGACACTGG + Intronic
1061653752 9:132071575-132071597 GGCACAGGTTCATGGGATACGGG - Intronic
1061819485 9:133218266-133218288 AGCAAATGATCCAGGGAGACCGG + Intergenic
1062241203 9:135539923-135539945 AGCAAATGATCCAGGGAGACCGG - Intergenic
1203753107 Un_GL000218v1:98319-98341 GGCAAATGTTCATCAGACACTGG - Intergenic
1187091316 X:16099723-16099745 GGCAAATGTTTCTGGGGCAGGGG - Intergenic
1192617436 X:72642285-72642307 GGCATATCTTACTGGGAAACAGG - Intronic
1193337050 X:80302658-80302680 GGAATTTATTCCTGGGATACAGG - Intergenic
1193370544 X:80691924-80691946 GTCAATTCTTCCTGGGAGACAGG + Exonic
1194012096 X:88574733-88574755 GGGATATCTTCCTGGGATGCAGG + Intergenic
1198413690 X:136397219-136397241 GCCAAATGTCCCTGGGAGAGGGG + Intronic
1201166751 Y:11215888-11215910 GGTAAATGTTCATCGGACACTGG - Intergenic