ID: 1053053202

View in Genome Browser
Species Human (GRCh38)
Location 9:34978100-34978122
Sequence TCTGCTCCATGCTATCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053053202_1053053207 -7 Left 1053053202 9:34978100-34978122 CCCCCAGGATAGCATGGAGCAGA 0: 1
1: 0
2: 0
3: 13
4: 186
Right 1053053207 9:34978116-34978138 GAGCAGAGAAGCTCGGTTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053053202 Original CRISPR TCTGCTCCATGCTATCCTGG GGG (reversed) Exonic
905529850 1:38669241-38669263 TCTGCTCCATGCAATCATTCAGG + Intergenic
905696412 1:39977547-39977569 TCTGCTCTAGGAGATCCTGGAGG - Intergenic
906629260 1:47351397-47351419 TCTGATACATGCTAACATGGAGG - Intronic
907523429 1:55039848-55039870 TCAGCTCCAGGCGGTCCTGGTGG + Exonic
909989139 1:82200355-82200377 ACAGCTCCATGCTATCTTGTTGG - Intergenic
913415435 1:118600989-118601011 TCTGCTCCATGTAGTCCTTGAGG + Intergenic
920746648 1:208635356-208635378 TCTGCTCCATGCTTCTCTGCTGG - Intergenic
921566769 1:216730839-216730861 CCTGCTCCATGCTATACTAAGGG + Intronic
923065856 1:230516729-230516751 TTTGCTCAATGTTATGCTGGTGG + Intergenic
923201226 1:231713659-231713681 TCTGCTTCATGATGTCCTAGAGG - Intronic
924605240 1:245528511-245528533 TTTGCTCCCTGCTGTCCTGGAGG - Intronic
1064985672 10:21207641-21207663 CCTGCTCCATGATCTCCTGCAGG - Intergenic
1065791370 10:29263616-29263638 TCTGCACCGTGCTATCCTCAGGG + Intergenic
1067223667 10:44361812-44361834 GCTTCTCCAGGCTTTCCTGGAGG + Intergenic
1070115000 10:73519873-73519895 GCTGCTGCATGCGATCCTGCAGG + Exonic
1070751187 10:78965007-78965029 GCTGCTGCATGCTTTTCTGGGGG - Intergenic
1071260410 10:83914418-83914440 TCTGCTCCATGCAGTCCTCCAGG + Intergenic
1073048391 10:100653354-100653376 TGTGCCCCATGCTGTCCTGGGGG + Intergenic
1075876058 10:125806683-125806705 TCTACTTCATGCTCTCATGGGGG + Intronic
1076247846 10:128961542-128961564 TCTGCTCCATGCAAGCCTTGCGG - Intergenic
1076252559 10:128995806-128995828 CCTGCTGCAGGCCATCCTGGAGG + Intergenic
1077423058 11:2461933-2461955 TCTGCTGTCTGCTGTCCTGGGGG + Intronic
1077493124 11:2871238-2871260 GCTGCTCCAGGCACTCCTGGAGG + Intergenic
1077748620 11:4937727-4937749 TCAGCTTCATGACATCCTGGTGG + Intronic
1079470445 11:20773134-20773156 CCTGCTCAATGCTCTCCTGCTGG + Intronic
1079820727 11:25124076-25124098 TCTGCTCCCTGCTATGATGAGGG + Intergenic
1080727251 11:34910789-34910811 TCTGCCTCTTGCTATCTTGGTGG - Intronic
1083910691 11:65707596-65707618 ACTGGTCCATGCAATCATGGCGG + Intergenic
1084816519 11:71650527-71650549 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
1089542361 11:119197276-119197298 CCAGCTCTGTGCTATCCTGGAGG + Intergenic
1089632743 11:119793773-119793795 TCTGCTCTGTGCTAACCTTGGGG - Intergenic
1089834115 11:121355194-121355216 TCTGAGCCATGCTATCCTCAGGG - Intergenic
1089892558 11:121896002-121896024 TCTGTTTCATGTTTTCCTGGAGG + Intergenic
1092426474 12:8379507-8379529 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1094467623 12:30770400-30770422 TCAGCTCCTTGCTTTACTGGAGG + Intergenic
1097491647 12:60279012-60279034 TCTGCTCCATGCAATCATTTGGG - Intergenic
1099665696 12:85626203-85626225 TCTGTCACATGCTATACTGGGGG - Intergenic
1100560269 12:95741474-95741496 TCTCCTCCATGCCAACCTGGAGG + Intronic
1102492882 12:113299427-113299449 TGTGCTCCAGGCCATGCTGGAGG - Exonic
1102799307 12:115717647-115717669 TCTGCTCCATGTCATTCTGGAGG - Intergenic
1103554324 12:121756910-121756932 TCTTCTCCCTGCTCTCCAGGTGG - Intronic
1104390230 12:128385872-128385894 TCTGCTCCATGAGTTGCTGGTGG + Intronic
1106467136 13:30023388-30023410 TCTGCTCTCAGCTATCCTGGAGG - Intergenic
1107261252 13:38494131-38494153 TCTGCACCATGAGAACCTGGTGG + Intergenic
1110413666 13:75229528-75229550 TCTACACCATGCCAGCCTGGGGG + Intergenic
1111975445 13:94962233-94962255 TGTGGTCCCTGCTATTCTGGAGG + Intergenic
1112578286 13:100656663-100656685 TCTGCTCCCAGCTATTCAGGAGG - Intronic
1112745219 13:102520063-102520085 TCTGCTCTAGGCTAGCCTTGAGG - Intergenic
1114526325 14:23368903-23368925 AATGCTCCATGGTAGCCTGGAGG + Intergenic
1118761961 14:68885450-68885472 TCTGCTCCACACGGTCCTGGTGG + Exonic
1119687592 14:76645021-76645043 AATGCTCCATGCTCCCCTGGTGG - Intergenic
1119825986 14:77657342-77657364 ACTGCTCCCTCCTCTCCTGGTGG - Intergenic
1119914517 14:78384739-78384761 TGTGCTCCATGGAATCCTGGAGG - Intronic
1120980995 14:90288881-90288903 TCTGCTCTATGCTGAGCTGGAGG - Exonic
1120996155 14:90420067-90420089 TCTGCCCCATGTCATTCTGGAGG + Intergenic
1122935817 14:104955621-104955643 TCTGCTCCAGGCTGTCCAGGAGG - Exonic
1123476074 15:20593243-20593265 TCTGTTCCATGCTAGGCTGCAGG - Intergenic
1123641938 15:22407121-22407143 TCTGTTCCATGCTAGGCTGCAGG + Intergenic
1124271073 15:28281409-28281431 TCTGCTGCTTACTAGCCTGGAGG + Intronic
1127628139 15:60800574-60800596 ACTGCTCTCTGCTAGCCTGGTGG - Intronic
1128074544 15:64818090-64818112 ACTGCTCCATGCTCTCCTTAGGG - Exonic
1128776951 15:70327926-70327948 TCAGCCCCATCCAATCCTGGTGG + Intergenic
1129269250 15:74410869-74410891 TCTGCTCCACGTTCTCCTTGTGG + Exonic
1131217192 15:90548009-90548031 TGTACTCCCTGCTACCCTGGGGG - Intronic
1131567136 15:93496522-93496544 TCTGCTCCATGTTCTTTTGGAGG + Intergenic
1132826057 16:1906248-1906270 TCTGCACCAGGCTCTCCTGCCGG + Intergenic
1133354589 16:5126675-5126697 TCTGATCCCAGCTACCCTGGAGG + Intergenic
1134386649 16:13779751-13779773 TCTGCTCCTTACTATCCACGTGG - Intergenic
1136057065 16:27698413-27698435 TGTGCTCCAAGCCATCCAGGTGG + Exonic
1137793682 16:51196645-51196667 TTTGCTCCATGCTGGTCTGGAGG + Intergenic
1138578128 16:57921804-57921826 TCTGCTCCATGCAATCATTTAGG - Intronic
1140419628 16:74807667-74807689 TGTGCTCCCTGCTGTCTTGGCGG - Intergenic
1146003170 17:29143796-29143818 TCTGCTCCATCCTGTACTGAAGG + Intronic
1146273428 17:31499096-31499118 TCTGGTCCATGCTTTTCTTGGGG + Intronic
1148799704 17:50215929-50215951 TTGGTTCCATGGTATCCTGGGGG - Intergenic
1149991145 17:61384228-61384250 GCTACTCCATGCCAACCTGGGGG - Intronic
1150338179 17:64344979-64345001 TCTGCTTCACCCAATCCTGGAGG + Intronic
1153738407 18:8096992-8097014 TCTGCTTCATCCTATTTTGGTGG + Intronic
1156750056 18:40441433-40441455 TCTCCTTCAAGCTATTCTGGTGG + Intergenic
1159463789 18:68753671-68753693 TCTGGTCCTAGCTATTCTGGAGG - Intronic
1160034127 18:75285731-75285753 TCTGTGCCAGGCTGTCCTGGGGG - Exonic
1161410032 19:4112051-4112073 GCTGCTCCTTGCCATGCTGGGGG - Intronic
1168245693 19:55112277-55112299 TGGGCTCCAAGCAATCCTGGAGG + Intronic
1168712665 19:58510907-58510929 TCTCCTCCAGGCTCTCCCGGAGG + Exonic
929420415 2:41784504-41784526 CCTGCTCTGTGCTGTCCTGGAGG - Intergenic
929584153 2:43102868-43102890 TCTGCTTGATGCTGTGCTGGTGG - Intergenic
929601224 2:43206069-43206091 GCTGCTCCCTTCCATCCTGGAGG - Intergenic
929886178 2:45880694-45880716 TCTGCTGCATTCTTTCCTAGAGG - Intronic
933047361 2:77556218-77556240 TCTGCTCAATGCTTTTCTTGGGG + Intronic
934067123 2:88350651-88350673 TCTGCTCTGTGGTCTCCTGGGGG - Intergenic
935705507 2:105853472-105853494 TCTGCTCAATACTATAATGGCGG - Intronic
940161480 2:150718463-150718485 TCTGTTTCTTGTTATCCTGGAGG - Intergenic
941557849 2:167005672-167005694 CCTGCTCCATGCTAACCTCTGGG - Intronic
943973420 2:194440607-194440629 TCTACTCCACTCTAGCCTGGGGG - Intergenic
946056969 2:216911113-216911135 TCTGCCCCTTGCTATGTTGGTGG + Intergenic
946925900 2:224626324-224626346 ACTGCTCCATGCTATTCTTGTGG + Intergenic
948172350 2:235914863-235914885 TCCGATGCATGCTCTCCTGGGGG - Intronic
948317916 2:237043708-237043730 TCTGATCCAGGCTAGGCTGGAGG + Intergenic
948331086 2:237165989-237166011 TCTGCACCATTCTATCCAAGTGG + Intergenic
948403742 2:237702515-237702537 TCTGCTCCATCCTAACCCCGCGG + Intronic
948653611 2:239463909-239463931 TCTGCTCCCTGCGGTCCTAGGGG + Intergenic
949049461 2:241889388-241889410 TCTGTTCCATACTGTACTGGGGG - Intergenic
1170569239 20:17623549-17623571 TGCGCTCCATGCTGTCCAGGTGG - Intronic
1170834901 20:19875783-19875805 TCTGCTTCATTCCATCCTGCAGG - Intergenic
1172357804 20:34292004-34292026 TTTGCTCACTGCTATCCTGTGGG + Intronic
1175610853 20:60349957-60349979 TGTGCTCCCGGCTATCCAGGAGG - Intergenic
1177272305 21:18865439-18865461 TTTGCCCCATGCTCTTCTGGTGG + Intergenic
1181626158 22:24123595-24123617 TCTGGGGCATGCCATCCTGGGGG + Intronic
1182143230 22:27980615-27980637 TCTGCTCCATGTGCTGCTGGTGG + Exonic
1183978052 22:41524565-41524587 TCTCCTCACAGCTATCCTGGAGG - Intronic
1184100841 22:42341141-42341163 TCTGCTCCTTGCCTTTCTGGGGG + Intronic
1184583645 22:45433532-45433554 TCTGCTCCATGCGATACAAGCGG - Intergenic
1184687214 22:46102109-46102131 TCTGCTGTATGCCAGCCTGGTGG - Intronic
1185376918 22:50486942-50486964 TCTGCTGACTGCTCTCCTGGTGG + Intronic
951864210 3:27289171-27289193 TCTGCTCCATGCGATCATTTGGG - Intronic
953042790 3:39269656-39269678 ACTGCTCCCTGCCATCCAGGGGG + Intronic
954137205 3:48587442-48587464 CCAGCTACATCCTATCCTGGCGG - Exonic
955783045 3:62506647-62506669 TCTACTCCATGTTATTTTGGTGG + Intronic
956780486 3:72599426-72599448 TCTGCTCCCTGCACACCTGGAGG - Intergenic
960760095 3:121063841-121063863 TCTGAAACATGCTATCTTGGTGG - Intronic
961062608 3:123844218-123844240 TCTGTTCCATCCTAGCTTGGGGG - Intronic
961282959 3:125777911-125777933 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
961546263 3:127635984-127636006 TCTGCTCAAGGCTAGCCTGCAGG - Intronic
966555083 3:181249990-181250012 TCTGCACCATGCTGTCCTCAGGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968697120 4:2036629-2036651 TCTTCTCCACGCTGTCCTCGAGG - Intronic
969014758 4:4096511-4096533 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
969798371 4:9543449-9543471 TCTGCACCCTGATGTCCTGGGGG + Intergenic
975234249 4:71972852-71972874 TGTGGTCCAAGCTATTCTGGAGG - Intergenic
977283968 4:95078877-95078899 TGTGGTCCCAGCTATCCTGGAGG - Intronic
980783743 4:137525688-137525710 TGTGGTCAAAGCTATCCTGGAGG - Intronic
982943461 4:161588543-161588565 TCTGGTCTTTGCTATTCTGGAGG - Intronic
983706157 4:170662302-170662324 TCTGCTCCTTACTATACAGGTGG - Intergenic
984576576 4:181455368-181455390 TCTGCTCCATGGCATCATGTGGG - Intergenic
986438525 5:7758739-7758761 CCTGCTCGATGGAATCCTGGAGG + Intronic
987209871 5:15670043-15670065 TCTGCTACATACTATCTTGATGG - Intronic
988554459 5:32224087-32224109 TCTTTTCCATCCTCTCCTGGAGG + Intergenic
991710614 5:69404897-69404919 GCTGCTACATTCTAGCCTGGGGG + Intronic
992111310 5:73497080-73497102 TCTCCTCCATGTTATATTGGAGG - Intergenic
992194032 5:74322130-74322152 TCTCATCTCTGCTATCCTGGGGG + Intergenic
997228862 5:132228506-132228528 TCTGGTCCAGGCAGTCCTGGTGG + Intronic
998001068 5:138626366-138626388 TGTGCTCCATGCAACCCTGAGGG - Intronic
999157999 5:149472187-149472209 TCAGCTCCCTGCTTTCCAGGAGG - Intergenic
1002690491 5:181046372-181046394 TCTGCTCCCTGCTATGCCTGTGG - Intronic
1004753143 6:18584006-18584028 TCTGCACCTCGCTATCCTGTGGG - Intergenic
1005271946 6:24175455-24175477 TCTGCTCTATGAAATCCTAGAGG + Intronic
1007695786 6:43733728-43733750 TCTCCTCCCTGCCATCCTTGGGG + Intergenic
1012896571 6:104956184-104956206 TCTGCTGCCGCCTATCCTGGCGG + Intergenic
1013187215 6:107770268-107770290 TCTGCTTCCTACTATCTTGGTGG - Intronic
1013201492 6:107900772-107900794 TCTGCTCCATTCTTTCATTGTGG - Intronic
1013255559 6:108380904-108380926 TCAGCTGGATGCTATCATGGGGG + Intronic
1015112287 6:129606979-129607001 TGTGATCCCTGCTATCCGGGAGG - Intronic
1016178280 6:141108109-141108131 ACTGTACCAAGCTATCCTGGGGG - Intergenic
1017557666 6:155589408-155589430 AATGCTCTGTGCTATCCTGGAGG + Intergenic
1019511532 7:1419948-1419970 CCTGCTCCGTGCAACCCTGGAGG + Intergenic
1019636276 7:2077710-2077732 TCTGCTCCCTGCTAGCCTCCTGG - Intronic
1021008983 7:15438731-15438753 TCTGCTCCATGCTGTCATTCAGG - Intronic
1022498707 7:30869160-30869182 TCTCCTCCATGTCCTCCTGGGGG - Intronic
1026398313 7:69982445-69982467 CCTGCTCCAGGCTATCCTGAGGG + Intronic
1028652082 7:93161288-93161310 TCTGGTCTATGCTATGCAGGTGG - Intergenic
1029073430 7:97918140-97918162 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1030023436 7:105298654-105298676 TCTGAGCCATGCTATCCTATGGG - Intronic
1030673035 7:112357762-112357784 ATTGCTCCATGATATTCTGGAGG - Intergenic
1030730262 7:112979437-112979459 TATGATCCATGCTATCCTGAGGG - Intergenic
1030772913 7:113496974-113496996 TATGATCCATGCTATCCTGAGGG - Intergenic
1033155872 7:138956507-138956529 TTTCCTCCATACTATTCTGGTGG + Intronic
1033615164 7:143007390-143007412 TCTGCCCCAGGCTCTTCTGGAGG + Intergenic
1036256481 8:7210589-7210611 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036308531 8:7669174-7669196 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036510373 8:9394447-9394469 TGTGCTCCAGGGAATCCTGGGGG - Intergenic
1036889961 8:12590098-12590120 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036897574 8:12648259-12648281 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1038376078 8:27041751-27041773 TCAGTGCCAAGCTATCCTGGGGG + Intergenic
1038698248 8:29825533-29825555 TCTGCTCCATGATGTCTCGGTGG + Intergenic
1040408716 8:47134031-47134053 GCTGCTCCCTGCAACCCTGGAGG - Intergenic
1042175441 8:66033516-66033538 TCTTCTCCATGACATCTTGGTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046044210 8:108944656-108944678 TCTGCCACATGCTATCTTTGTGG + Intergenic
1048975816 8:139672601-139672623 TCTGCTACAGGCTCCCCTGGGGG - Intronic
1049241580 8:141540128-141540150 CCTGCTCCATCCTGACCTGGAGG - Intergenic
1049288216 8:141788018-141788040 TCTGCTCCATGCATTTGTGGGGG + Intergenic
1050056610 9:1661740-1661762 TCTGCTCCATGCTGTCATTCAGG - Intergenic
1050813648 9:9781089-9781111 TCTGCTTGATGCTTTCATGGTGG + Intronic
1051955407 9:22687072-22687094 TCTTCTCTATGCTTTCCTGGAGG + Intergenic
1053053202 9:34978100-34978122 TCTGCTCCATGCTATCCTGGGGG - Exonic
1059618733 9:115979732-115979754 TGTGGTCCAAGCTATTCTGGAGG + Intergenic
1062229595 9:135474357-135474379 CCTGCCCCATCCTGTCCTGGGGG + Intergenic
1062314128 9:135957320-135957342 TCTGCTCCCTGAAATACTGGGGG + Intronic
1062716941 9:138015454-138015476 TCTGCTTCCTGTTCTCCTGGTGG + Intronic
1187151139 X:16682666-16682688 TCTGCTGCATGCTTTCCTTCTGG + Intronic
1188262111 X:28034359-28034381 GCTCCTCCCTGGTATCCTGGAGG - Intergenic
1189290999 X:39886125-39886147 TCTGCTCCATGAAATCCTCAGGG - Intergenic
1190691130 X:52914040-52914062 TTTGCTCCCTGCTGTGCTGGCGG + Intergenic
1190694853 X:52941752-52941774 TTTGCTCCCTGCTGTGCTGGCGG - Intronic
1193700729 X:84757424-84757446 TCTGCTCAATGCTATTGTGCAGG + Intergenic
1195682543 X:107559705-107559727 TCTTCCCTATGCTATCCTAGAGG - Intronic
1198552955 X:137763413-137763435 CCTGCTATATGCTTTCCTGGAGG + Intergenic
1198602349 X:138297015-138297037 TCTGATCCACGCAATCCTGTTGG - Intergenic
1199986903 X:152959231-152959253 TCTCCCCCAAGCTACCCTGGAGG - Intronic