ID: 1053054287

View in Genome Browser
Species Human (GRCh38)
Location 9:34985055-34985077
Sequence CTCCAGGACCCATGCCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053054287_1053054290 4 Left 1053054287 9:34985055-34985077 CCATGAAGGCATGGGTCCTGGAG No data
Right 1053054290 9:34985082-34985104 GCAGATTTGAAGGATGCAGATGG No data
1053054287_1053054291 14 Left 1053054287 9:34985055-34985077 CCATGAAGGCATGGGTCCTGGAG No data
Right 1053054291 9:34985092-34985114 AGGATGCAGATGGTGATGTTTGG No data
1053054287_1053054289 -6 Left 1053054287 9:34985055-34985077 CCATGAAGGCATGGGTCCTGGAG No data
Right 1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG No data
1053054287_1053054292 21 Left 1053054287 9:34985055-34985077 CCATGAAGGCATGGGTCCTGGAG No data
Right 1053054292 9:34985099-34985121 AGATGGTGATGTTTGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053054287 Original CRISPR CTCCAGGACCCATGCCTTCA TGG (reversed) Intergenic
No off target data available for this crispr