ID: 1053054289

View in Genome Browser
Species Human (GRCh38)
Location 9:34985072-34985094
Sequence CTGGAGAGAAGCAGATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053054287_1053054289 -6 Left 1053054287 9:34985055-34985077 CCATGAAGGCATGGGTCCTGGAG No data
Right 1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053054289 Original CRISPR CTGGAGAGAAGCAGATTTGA AGG Intergenic
No off target data available for this crispr