ID: 1053055203

View in Genome Browser
Species Human (GRCh38)
Location 9:34989815-34989837
Sequence CCCGCAGCTCCTCACCGGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053055196_1053055203 19 Left 1053055196 9:34989773-34989795 CCGGGGGAGGGGGCAGCGGCTGT 0: 1
1: 0
2: 4
3: 72
4: 641
Right 1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 117
1053055194_1053055203 25 Left 1053055194 9:34989767-34989789 CCGGAGCCGGGGGAGGGGGCAGC 0: 1
1: 0
2: 8
3: 103
4: 689
Right 1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG 0: 1
1: 0
2: 1
3: 18
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053055203 Original CRISPR CCCGCAGCTCCTCACCGGTG AGG Exonic
900092372 1:926003-926025 CCCGCATCTCACCACCGGGGAGG - Exonic
900459217 1:2792866-2792888 CCCGCAGCTCTTCACCTGAGGGG - Intronic
900522542 1:3112711-3112733 CGGGCAGCTGCTCCCCGGTGAGG + Intronic
900644039 1:3700930-3700952 CCTCCAGCTCCTGGCCGGTGAGG + Intronic
900786335 1:4653013-4653035 CCCACAGCCCCTCCCCGGGGAGG - Intergenic
901451508 1:9339181-9339203 CCCACAGGTCCTCACCGCTGGGG - Intronic
902197156 1:14806168-14806190 CCTGAAGCTCCTCAAGGGTGTGG + Intronic
904042411 1:27592452-27592474 CCCCCAGCTCCGCACCCCTGTGG - Intronic
915147339 1:153802857-153802879 CCCTCAGCTCCTCTCCGGGGAGG + Intergenic
916128563 1:161592129-161592151 CTCCCAGCTCTTCACCGATGGGG + Intronic
916138480 1:161673960-161673982 CTCCCAGCTCTTCACCGATGGGG + Exonic
916721756 1:167489716-167489738 GCCGCAGCTCCTCAGCAGCGGGG - Intronic
917445070 1:175099909-175099931 CCCCCAGCGCCTCTCTGGTGGGG + Intronic
917836658 1:178946597-178946619 CCTGAAGCTCCACTCCGGTGTGG - Intergenic
919770308 1:201154275-201154297 CCCGCAGCTCCTCCCCGCTCGGG + Exonic
920260325 1:204684530-204684552 CCCGCGGCTCCTCGCCGGCTGGG + Intronic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1067478347 10:46580261-46580283 CAGGCAGCTCCTCATAGGTGAGG - Exonic
1067616391 10:47761526-47761548 CAGGCAGCTCCTCATAGGTGAGG + Intergenic
1071553328 10:86584152-86584174 CTCCCAGGTCCTCACTGGTGAGG - Intergenic
1075115749 10:119626076-119626098 GCCTCAGCTCCTCCCGGGTGTGG + Intergenic
1075680022 10:124325101-124325123 CCCGCAGCTGCTGGCAGGTGCGG + Intergenic
1076722244 10:132397735-132397757 CTGGCAGTTCCTCACAGGTGGGG + Intronic
1076876030 10:133215937-133215959 CCCTCACCTCCTCACGGGAGCGG + Intronic
1076919498 10:133444400-133444422 ACCTCAGCACCTCACAGGTGAGG - Intergenic
1076994803 11:292670-292692 CACGCAGCACCTCACCTGGGTGG - Exonic
1080683391 11:34496181-34496203 CCAGCAACACCTCCCCGGTGTGG - Intronic
1081641903 11:44761666-44761688 CCCGCAGCTCCTTCCCGGCATGG + Intronic
1084319509 11:68365656-68365678 CCTGCAGCTGCACACCCGTGGGG - Exonic
1085076671 11:73597917-73597939 CCTGCAGCTGCTCACCGGTGAGG - Exonic
1091406219 12:211120-211142 CCCGCAGCCCCTCACCTCTGAGG + Intronic
1091935565 12:4431973-4431995 CCAGCCCCTCCTAACCGGTGCGG + Intronic
1096758143 12:53817120-53817142 CCCCCAGCTCCTCAGTGGGGTGG + Intergenic
1100761872 12:97816217-97816239 CCCCCAGCTCCTCATGGCTGAGG - Intergenic
1105291873 13:19058544-19058566 CCCTCAGGTCATCACCGGCGAGG + Intergenic
1112580792 13:100674875-100674897 CCCGCAGCTCCCCACGCGCGCGG + Intronic
1119124114 14:72109174-72109196 CCAGCAGCTTCTCTCCAGTGTGG + Intronic
1121629429 14:95411786-95411808 CCCTCAGCTCCTCTCCTCTGGGG + Intronic
1124373298 15:29115508-29115530 CCAGCAGCCCCACACCTGTGAGG + Intronic
1128379603 15:67102830-67102852 CCCTCTGCTCCTCCCAGGTGAGG + Intronic
1128582181 15:68818196-68818218 CCCGCCCCTCCTCCCCGGCGCGG - Intronic
1131091647 15:89628652-89628674 CCCGCGTCTCCTCCCGGGTGCGG + Exonic
1134523823 16:14929995-14930017 CCCCCAGCTCCTCTCCGGCCAGG - Intronic
1134549080 16:15130940-15130962 CCCCCAGCTCCTCTCCGGCCAGG + Intronic
1134711414 16:16328480-16328502 CCCCCAGCTCCTCTCCGGCCAGG - Intergenic
1134719265 16:16371779-16371801 CCCCCAGCTCCTCTCCGGCCAGG - Intergenic
1134948161 16:18340106-18340128 CCCCCAGCTCCTCTCCGGCCAGG + Intergenic
1134955415 16:18380213-18380235 CCCCCAGCTCCTCTCCGGCCAGG + Intergenic
1143512831 17:7405472-7405494 CCCGCAGCGCCTCACCCGGCGGG - Intronic
1145234586 17:21199763-21199785 CCCCCAGCTCCTCCCCGCTGCGG + Intronic
1149650373 17:58272733-58272755 CCTGCAGCCCCTCACCTGGGAGG + Exonic
1151515516 17:74592525-74592547 CCCGCAGCTCCTCAATGCTTGGG - Exonic
1151657711 17:75503410-75503432 CCTGCAGCTCCTCCCAGGTGAGG + Exonic
1152068609 17:78124523-78124545 CCTGGAGCTCCTCACAGGCGCGG - Exonic
1152237578 17:79146614-79146636 CCCTCAGCTGCTCCCCAGTGAGG - Intronic
1152685531 17:81691921-81691943 CCCGCAGGTTCCCACCGCTGAGG - Intronic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1153515430 18:5896290-5896312 CCTCCTGCTCCTCCCCGGTGCGG + Intergenic
1153815725 18:8788338-8788360 CCCGTAGCTCCTCAGGGGTGTGG + Intronic
1155769000 18:29673019-29673041 CCCTCAGCTCATCACCAGGGAGG + Intergenic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1158579694 18:58671177-58671199 CCGGCAGCTCCTCTACGGCGGGG - Intergenic
1161220335 19:3115504-3115526 CCCACAGCTCCTTCCCTGTGTGG - Intronic
1162130839 19:8525464-8525486 GACGCAGCTCCTCACCTCTGGGG + Exonic
1163842748 19:19621357-19621379 ACCCCACCTCCTCACTGGTGAGG + Intergenic
1165326309 19:35116352-35116374 GCCCCAGCTGCTCACCTGTGTGG - Exonic
1166726682 19:45032682-45032704 CCTGCAGCGGCTCACCGATGGGG + Exonic
1168282560 19:55313179-55313201 CCCGTAGCTCCTCACAGACGGGG + Intronic
927713663 2:25340447-25340469 CCCCCAGCCCCTCATCGCTGGGG - Intronic
932761182 2:74440212-74440234 CCCTGAGGTCCTCACCTGTGTGG - Intronic
932780407 2:74555446-74555468 GCCGCAGCTCCTCACCGGAAAGG - Exonic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
946464853 2:219902799-219902821 CCCCTAGCTCCTCCCCTGTGGGG - Intergenic
948807416 2:240459022-240459044 TCCGCAGGTGCTCACCTGTGGGG - Exonic
948921512 2:241068054-241068076 CCTGCCGCTCCTCACCTGAGCGG + Intronic
1169146173 20:3253991-3254013 CCCAGAGCTCCTCACCTGAGAGG - Intronic
1171411193 20:24949879-24949901 CCCGCAGCTCCTCTGCGGGACGG + Intronic
1172210897 20:33197822-33197844 CCCACAGCTGCTAACAGGTGGGG + Intergenic
1172738195 20:37144712-37144734 CTCACAGTTCCTCACCAGTGGGG - Intronic
1174414404 20:50357576-50357598 CCTTGGGCTCCTCACCGGTGGGG - Intergenic
1175575567 20:60058200-60058222 TTCCCAGCTCCTCACAGGTGCGG - Intronic
1175581649 20:60104471-60104493 CCTGCTGCCCCTCACTGGTGGGG + Intergenic
1179627802 21:42658405-42658427 CCCCCAGCTCCTCAGGGGAGAGG + Intronic
1179905110 21:44418651-44418673 CCAGCAATGCCTCACCGGTGAGG + Intronic
1179939657 21:44629233-44629255 CATGCAGCTCCTCTCAGGTGTGG - Intronic
1180109726 21:45642445-45642467 CCCGCGGGTCCTCGCCGGGGTGG - Intergenic
1180831914 22:18910899-18910921 CCCGCTGCTCCTCACGGATCCGG - Exonic
1181067931 22:20315443-20315465 CCCGCTGCTCCTCACGGATCCGG + Exonic
1181573137 22:23778665-23778687 CCCCCACCTCCTCCCCAGTGTGG - Intronic
1181864695 22:25846091-25846113 TCCGCAGCTCCTCTCTGGTGGGG - Exonic
1183413716 22:37671012-37671034 CCCGCCGCTCCTCTCAGGTAAGG - Intergenic
1184874484 22:47264830-47264852 TCTGCAGCTCCTCACTAGTGTGG - Intergenic
1203281992 22_KI270734v1_random:136170-136192 CCCGCTGCTCCTCACGGATCCGG - Intergenic
949667440 3:6356502-6356524 CCCGCAGCTTCTCCTCGGAGTGG - Intergenic
950644161 3:14367285-14367307 CCCCCAGCTCCCCTCAGGTGTGG - Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954701275 3:52452133-52452155 CCTGCAGCTCCTCAGGGGTGGGG + Exonic
954748883 3:52802777-52802799 CCAGCAGCTGCTCAATGGTGAGG - Exonic
958155132 3:89747392-89747414 ACCGAAGCTGCTCACCAGTGTGG - Intergenic
958742794 3:98095447-98095469 ACCGCAGCTCCTCACCAGTAAGG - Intergenic
959085802 3:101849658-101849680 CCCGCAGCCCCTCTCCGCCGCGG - Exonic
968515065 4:1012312-1012334 CCCACAGCTTCTCCCCGCTGCGG + Intronic
969725904 4:8917963-8917985 CCCTCAGCTCCTCAGCGGCGTGG + Intergenic
971003816 4:22351844-22351866 CCCATAGCTCCTCACCGGGCAGG + Intronic
973822422 4:54674217-54674239 CCAGCAGCTTCTCCCCAGTGTGG + Intronic
979545887 4:121939610-121939632 CCCTCAGCTCCTCTGTGGTGTGG + Intronic
985171831 4:187158226-187158248 TCTGCAGCTCCTCAACGGTGTGG + Intergenic
995442834 5:112211137-112211159 CCCACAGCTCCTGAGTGGTGGGG + Intronic
997065590 5:130555536-130555558 CCTGCAACTCCTCACTGGTCAGG + Intergenic
1002566544 5:180115425-180115447 CCCGCAGCCCTTCACAGGCGGGG - Intronic
1007784812 6:44273499-44273521 CCACCAGCTCCTCACCTGGGTGG - Exonic
1012550950 6:100464552-100464574 CCCGCAGCTCCGCGGTGGTGTGG - Intronic
1017877630 6:158537159-158537181 CCCGCAGCTCCTTTCCGGGGAGG - Intronic
1019020875 6:168916699-168916721 CCCCCAGCTCCTCAGGGATGAGG - Intergenic
1019607188 7:1916064-1916086 CCTGCACTTCCTCACAGGTGAGG - Intronic
1019736612 7:2653003-2653025 CCCGCAGCCCCTCACCTTAGTGG - Exonic
1027269063 7:76510466-76510488 CCCCCAGCTCCTCCCTGCTGTGG + Intronic
1028622137 7:92836463-92836485 CGCACAGCTCCTCACCTGAGGGG + Intronic
1029734390 7:102457561-102457583 CCTGCTGGTCCTCACCGGGGCGG - Exonic
1034438656 7:151075782-151075804 CCCCCAGCTCCCCACCGGAAGGG + Intronic
1036085634 8:5610149-5610171 CACGCAGCACCTGAACGGTGTGG + Intergenic
1044900035 8:96934456-96934478 CCCTCATCTCCTCACCTCTGGGG + Intronic
1046276432 8:111966484-111966506 CACCCAGCTCCTTACCTGTGTGG - Intergenic
1047998533 8:130358431-130358453 GCGGCAGCTCCTCAGCGGCGGGG + Intronic
1049283278 8:141761365-141761387 CCCTCAGCCCCACACTGGTGAGG + Intergenic
1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG + Exonic
1056858664 9:90158919-90158941 CCCCCAACCCCTCACTGGTGTGG - Intergenic
1058111066 9:101030715-101030737 CCTGCTGCTCCTCACGGGTGGGG + Intronic
1061816043 9:133197202-133197224 CCCCCAGCCCCTCACCTCTGGGG - Intergenic
1062497262 9:136837701-136837723 CCCCCAGGCCCTCACAGGTGGGG + Intronic
1185775289 X:2798199-2798221 CCCTCAGATCCTCTCCGGTTTGG + Intronic
1189268088 X:39731512-39731534 CACCCAGCTCCTCCCTGGTGGGG - Intergenic
1190328724 X:49222823-49222845 CCCCCAGATCCTGACAGGTGAGG - Exonic
1194067754 X:89283771-89283793 CCCACGTCTCCTCACTGGTGAGG - Intergenic
1195278091 X:103301999-103302021 CCAGCAGCTTCTCAGCTGTGTGG + Intergenic
1199966953 X:152828536-152828558 CCTGCAGCTCCTCATCAGTCAGG + Exonic
1200721903 Y:6617932-6617954 CCCACGTCTCCTCACTGGTGAGG - Intergenic