ID: 1053055572

View in Genome Browser
Species Human (GRCh38)
Location 9:34991458-34991480
Sequence CAGGGACACCAAAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053055563_1053055572 11 Left 1053055563 9:34991424-34991446 CCAGGGAGGAAGCTGGCCGGGTG 0: 1
1: 0
2: 1
3: 32
4: 263
Right 1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG 0: 1
1: 0
2: 6
3: 27
4: 317
1053055567_1053055572 -5 Left 1053055567 9:34991440-34991462 CCGGGTGTGGAGGTAATGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG 0: 1
1: 0
2: 6
3: 27
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053055572 Original CRISPR CAGGGACACCAAAAGGAGGT GGG Intronic
900536970 1:3183516-3183538 CAGGGACAGCAAAATGAGACGGG + Intronic
900639930 1:3683856-3683878 CAGGGACCCCCAAAGGAAGATGG + Intronic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902679716 1:18034561-18034583 AAAAGAAACCAAAAGGAGGTTGG + Intergenic
904715063 1:32461558-32461580 AAGGGACACTAGAAGGAGATGGG - Intergenic
905016208 1:34780641-34780663 CAGGGACTCCCAAGGGAGGCTGG + Intronic
905023824 1:34836493-34836515 CAGGGACTCCACAAGGGGGCAGG - Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905237369 1:36559369-36559391 CAGGTAAACCAAGTGGAGGTCGG - Intergenic
905523823 1:38621734-38621756 CAGGGACACCTAGAGGGGGGTGG - Intergenic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
907617733 1:55941726-55941748 CTGATACACTAAAAGGAGGTGGG - Intergenic
910207126 1:84759310-84759332 CAGGGCCACGGGAAGGAGGTGGG - Intergenic
912269367 1:108193339-108193361 TAGGGACTCCAAAAGGGGGGAGG - Intronic
912520845 1:110243678-110243700 CAGGGAGAGAAAAAGCAGGTAGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
915884280 1:159705915-159705937 CAGGCACACCAATAGCAGGGAGG - Intergenic
916745058 1:167678792-167678814 CAGGGACAACAAGAGGGGGCGGG - Intronic
916887773 1:169086780-169086802 CGGGGACATCAAAAGCAGTTTGG - Intergenic
917973092 1:180220832-180220854 GTGGGACTCCAAAAGGCGGTAGG + Intergenic
918005633 1:180539856-180539878 CACTGACAGCAAGAGGAGGTAGG + Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918402891 1:184181166-184181188 CAGGGAACCCAAACTGAGGTGGG + Intergenic
918813576 1:189152316-189152338 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
918930628 1:190851917-190851939 CGGAGACTCCAAAAGGTGGTAGG - Intergenic
919016253 1:192041065-192041087 CTGGGCCACCACAAGGAGCTTGG - Intergenic
920042424 1:203110504-203110526 TAGGGACTCCAAAAGGAGGGCGG + Intronic
921999971 1:221467162-221467184 AAAGGACACCAAAAGCAGGCAGG - Intergenic
923714071 1:236410249-236410271 TAGGGACTCCAAAAGGGGGGAGG - Intronic
924073345 1:240306427-240306449 TGGGGACTCCAAAAGGAGGGAGG - Intronic
1063482848 10:6391562-6391584 GAGGGACACTAAAAGGATGAAGG - Intergenic
1063711028 10:8478865-8478887 CAGCGGCACCAAAAAGAGTTGGG + Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064889748 10:20157285-20157307 CAGGGAAACAAAAATGAGTTTGG + Intronic
1065038729 10:21668291-21668313 AAAGGAGACCAGAAGGAGGTGGG - Intronic
1067415988 10:46103570-46103592 TGGGGAAACCAAAAGGAAGTGGG - Intergenic
1067663411 10:48253435-48253457 CATGGAGACCAAAAGGCAGTTGG + Intronic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1070655041 10:78265651-78265673 CAGGGATATTAAAAGGAGGGAGG + Intergenic
1071797806 10:89025005-89025027 CAGGGAAACTCAAAGGAGCTTGG - Intergenic
1072116427 10:92374478-92374500 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
1072161218 10:92768743-92768765 CATGGACGCCAGAAGGCGGTGGG + Intergenic
1072381568 10:94877714-94877736 AATGGACACCAAAAGCAAGTAGG - Intergenic
1072863895 10:99037262-99037284 CTGGGACACAAAAAGGACATTGG + Intronic
1075908283 10:126101992-126102014 CAGGAACACCCAAAGATGGTGGG - Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077548300 11:3186547-3186569 CGGTGACTCCAAAAGGAGGGAGG - Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1080776190 11:35388934-35388956 CGGGGACTCCAAAAGGGGCTGGG + Intronic
1080780761 11:35427829-35427851 CGGGGACTCCAAAAGGGGCTGGG - Intergenic
1081781865 11:45718620-45718642 TAGGGACACCAAATGCAAGTTGG + Intergenic
1082059290 11:47846911-47846933 TAGGGATTCCAAAAGGAGGGAGG - Intronic
1082093677 11:48109658-48109680 CAGGGCCAAAAAAAGGGGGTTGG - Intronic
1083150589 11:60789487-60789509 CATGGGCACAAAAAGGAGTTGGG - Intronic
1086961236 11:92981744-92981766 CAGGGACCCCACAAAGAAGTTGG - Exonic
1087351544 11:97039931-97039953 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
1091139948 11:133226453-133226475 CAGGGATACAAGAAAGAGGTTGG - Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092529774 12:9334823-9334845 CTGGGACCCCAAAAGGATGAGGG + Intergenic
1094384661 12:29881117-29881139 TAGGGACTCCAAAAGGGGGAAGG - Intergenic
1096443750 12:51669480-51669502 GAGGGAGACCAGAAGAAGGTGGG - Intronic
1096595176 12:52690601-52690623 CAGGTACAGCAAAGGGAGCTTGG + Exonic
1098129047 12:67329071-67329093 CAGTGACTCCAAAAGGAGAGAGG - Intergenic
1099500874 12:83413056-83413078 CAGGGACTCCAAAAGGAGAGCGG - Intergenic
1104472548 12:129042181-129042203 CAGGTACACCAAACAGACGTAGG + Intergenic
1105769567 13:23595623-23595645 CAGGGACACCAATAAAATGTAGG - Intronic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1108328002 13:49353820-49353842 CATAGACACCAAATGGAGATGGG - Intronic
1109883965 13:68518209-68518231 TGGGGACACCAAAAGCAGGGAGG - Intergenic
1110270865 13:73588813-73588835 TAGGGACTCCAAAAGGGGGAGGG + Intergenic
1111472314 13:88699099-88699121 CAGGGACTCCAAAAAGGGGGAGG + Intergenic
1112307047 13:98284271-98284293 CAGGGAAACCAAAAGATTGTTGG + Intronic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113269745 13:108660595-108660617 AATGGACACCAAAAGGAAGCAGG - Intronic
1115350435 14:32389162-32389184 AATGGACACCAAAAGCAAGTAGG - Intronic
1115663464 14:35520968-35520990 CAGGAATACCAAAGGGAAGTAGG + Intergenic
1115914944 14:38301764-38301786 TAGGGACACCTAGAGGAGCTTGG - Intergenic
1117000285 14:51364939-51364961 GAGGGTCAGCAAAAGGTGGTGGG + Intergenic
1117103593 14:52376460-52376482 AATGGACACCAAAAGGAAGCAGG - Intergenic
1117966261 14:61209811-61209833 CAGGGAGTTCAAAAGGAGGGAGG - Intronic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119455703 14:74753790-74753812 CAGGGACATAAAAAGGAATTTGG - Intergenic
1119757845 14:77131400-77131422 CAGGGAGACCTACAGGATGTTGG - Exonic
1121460069 14:94068181-94068203 AATGGACACCAAAAGCAAGTAGG + Intronic
1122170220 14:99867085-99867107 TGGGGACTCCAAAAGGAGGGTGG - Intronic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1124788943 15:32708364-32708386 CAGGGACTCAAAGAGGAGGAAGG + Intergenic
1125994790 15:44148105-44148127 GAGGGAAACAAAAAGGATGTGGG - Intronic
1126898561 15:53286697-53286719 TATGGACAGCTAAAGGAGGTGGG - Intergenic
1127065289 15:55230971-55230993 TAGGGACTCCAAAAGGGGGAAGG - Intronic
1131422317 15:92317394-92317416 CAGGTAAACTAAAACGAGGTGGG + Intergenic
1132648483 16:1009933-1009955 CAGGGACACCAGGAGGGGCTGGG + Intergenic
1133229768 16:4360938-4360960 CAGGGCCACCAAGACCAGGTAGG - Exonic
1135865734 16:26100123-26100145 TAGGGACTCGAAAAGGAGGGAGG + Intronic
1136134340 16:28245679-28245701 TAGGGACACCAAAAGAGGATTGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137920668 16:52485472-52485494 TGGGGACTCCAAAAGGACGTTGG + Intronic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1139429131 16:66901729-66901751 CAGGGACCCTAAATGTAGGTCGG - Intergenic
1141763411 16:86043742-86043764 CAGGGACCCCACAATGACGTTGG - Intergenic
1141914183 16:87082694-87082716 GAGGGCCTCCAAAAAGAGGTGGG - Intergenic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143955475 17:10664840-10664862 CAAGGACAAAAAAAGGAGGCAGG + Intergenic
1144080442 17:11759279-11759301 CAGAGACTCCAAAAGGTGGGAGG - Intronic
1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG + Intronic
1145013524 17:19382841-19382863 CAGGCACACCAAAGGGCAGTGGG + Exonic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146405531 17:32533611-32533633 CAGAGACACCCAGAGGAGCTTGG - Intronic
1147952169 17:44113304-44113326 CAGGGACACCCAGAGGTGGCTGG + Intronic
1151992470 17:77585141-77585163 TGGGGATTCCAAAAGGAGGTGGG - Intergenic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1153931329 18:9882293-9882315 GAAGGACACCAGAAGGAAGTTGG - Intergenic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1157284884 18:46370882-46370904 CAGGTACACGAAAAGGAGGATGG + Intronic
1157624333 18:49037408-49037430 TAGGGACTCCAAAACGAGGGAGG + Intergenic
1158553576 18:58457670-58457692 AAAGGACACCAAAAGGAGGCAGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162123281 19:8485574-8485596 CAGGGACACAAAACACAGGTGGG - Intronic
1163282437 19:16325719-16325741 CAGGGCCACCGAAAGGCGGCGGG - Exonic
1163490892 19:17616680-17616702 CAGGGACACTAAAAGCAGCCAGG + Intronic
1163630014 19:18413535-18413557 CTGGGAAATCAAAATGAGGTTGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164188743 19:22896355-22896377 CAGGGACTCCAAAAGGGAGGAGG - Intergenic
1164448365 19:28337048-28337070 TAGGGACTCCAAAAGGCGGGAGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1167609191 19:50498350-50498372 CAGAGACACAGAAAAGAGGTGGG + Intergenic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
925976995 2:9148666-9148688 CAGGGAAACAGAAAGGAGGGAGG - Intergenic
926058761 2:9792300-9792322 GAGTGACACCTAAAGAAGGTAGG + Intergenic
926399882 2:12486560-12486582 CAAGGCCACCAAAAACAGGTGGG - Intergenic
926722769 2:15973889-15973911 TAGGAACACCAAAAAGGGGTGGG - Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
927061509 2:19427161-19427183 CAGAGAGAAGAAAAGGAGGTAGG + Intergenic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
929136243 2:38626510-38626532 CACTGACATCAAAAGGATGTGGG - Intergenic
929303013 2:40327744-40327766 TGGGGACTCCAAAAGGAGGGAGG + Intronic
929401507 2:41587534-41587556 TAGGGACTCCAAAAGGAGGTGGG - Intergenic
929878784 2:45818967-45818989 TAGAGGCACTAAAAGGAGGTAGG + Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931476747 2:62595372-62595394 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
931795273 2:65702360-65702382 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
936892380 2:117387561-117387583 CATGGAAACCAAAAGCAAGTGGG - Intergenic
937234292 2:120421220-120421242 CAGAGAGACAGAAAGGAGGTTGG - Intergenic
937243934 2:120480196-120480218 TAGGGACAGAAAAAGGAGTTTGG - Intergenic
938138802 2:128780342-128780364 CAGGGACCACAACAGGAGATAGG + Intergenic
938228678 2:129639263-129639285 CAGGGACACCTCAAGGAGAGAGG + Intergenic
938228876 2:129640624-129640646 CAGGGACACCTCAAGGAGAGAGG - Intergenic
939117172 2:138073589-138073611 CAGGGACACCAAAGAGAGGGAGG - Intergenic
939635171 2:144573342-144573364 CAGGGTCACCAATAGGAGCTAGG + Intergenic
940359793 2:152785142-152785164 CAGGGACACCCAAAAAAGGAGGG + Intergenic
942011110 2:171763253-171763275 CAGAAACATCAAAAGCAGGTAGG + Intergenic
942421713 2:175814622-175814644 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
942527922 2:176875320-176875342 CAGGGACACCAAAGCAAGGGAGG + Intergenic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
943126442 2:183798480-183798502 TAGGGACTCCAAAAGGAGGTGGG - Intergenic
944649577 2:201816269-201816291 CAGGGACTCCAAAAGGGGAGAGG - Intronic
944848893 2:203696707-203696729 TAGAGACACCAAAAGGTGGGAGG - Intergenic
945075367 2:206033150-206033172 AATGGACACCAAAAGCAAGTAGG + Intronic
945283731 2:208061526-208061548 CAGGTTCCCCAAAAGGAGTTTGG - Intergenic
946784980 2:223234410-223234432 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
1169514061 20:6297099-6297121 CAGGGGCACCAAAGGAAGGGAGG + Intergenic
1169807824 20:9577504-9577526 CAGAGACTCCTAAAGGAGGCTGG - Intronic
1170628745 20:18050135-18050157 AAGGCCCACCAAAAGGAGTTGGG - Intronic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173374037 20:42467054-42467076 CAGGGAGACCAAAAACAGGGAGG + Intronic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1173648156 20:44646444-44646466 CAGGAAGACAAAAAGGAGGAGGG + Intronic
1173938923 20:46893949-46893971 CAGGGAGACTAAAAGGGGGGTGG + Intergenic
1175893604 20:62326449-62326471 CAGGGACTCACAAAGCAGGTGGG + Intronic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1180744539 22:18078501-18078523 CAGGTGCACCACCAGGAGGTCGG - Exonic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1180980461 22:19875887-19875909 CAGGGACCCCCAAGGGAGATGGG + Intronic
1181115731 22:20631707-20631729 CAGGGACAAAAAAAGAAGATGGG + Intergenic
1181629558 22:24143450-24143472 GAGCCACACCAAAAGGGGGTGGG - Intronic
1183068204 22:35378166-35378188 CAGGGACCCCAAGAGCAGGAGGG - Intergenic
1183597019 22:38818853-38818875 CTGGGACACACAAAGGAGGGGGG + Exonic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184392722 22:44214200-44214222 CAGGGACACAAAATCCAGGTAGG - Intronic
1184402678 22:44282889-44282911 CTGGGACACCACATGGAGGCTGG + Intronic
1184858071 22:47157325-47157347 CACGAACACCAAAAAGAGATCGG - Intronic
949695432 3:6688854-6688876 CAGAGACACCAAAAGGGGAAGGG + Intergenic
950387419 3:12671079-12671101 GAGGGGCACCAAGAGGAGGGAGG + Intergenic
950402686 3:12782050-12782072 CAGGGGCTCCAAAAGAAGGAGGG + Intergenic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
953796045 3:45986704-45986726 CAGGGACACCAAACTGAGGATGG + Intronic
955503945 3:59612599-59612621 CAGGCACAGAAAAAGGAGATGGG - Intergenic
956764721 3:72474790-72474812 CAGGGAGATCAAAAGCAGATAGG + Intergenic
957623591 3:82627968-82627990 CAGTGACACCTAGAGGAGCTAGG - Intergenic
958493501 3:94810319-94810341 AAGGGACATCAAAAGGAGATTGG - Intergenic
959098106 3:101978503-101978525 CAGGGACACTAAGAGGATGGAGG + Intergenic
959365317 3:105450986-105451008 AAAGTACACCCAAAGGAGGTAGG + Intronic
959580663 3:107979415-107979437 CAGGGCCACTAAAATGAGCTGGG - Intergenic
961670664 3:128526547-128526569 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
962329124 3:134462090-134462112 CAGGGACTGTAAAAGGAGGGAGG - Intergenic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
962412212 3:135151268-135151290 GAGGGACACTAGAAGGAGTTTGG - Intronic
963814473 3:149813780-149813802 CAGGGAAAGAAAAAGGGGGTGGG - Intronic
963919801 3:150894375-150894397 CATGGCCACCTCAAGGAGGTGGG + Intronic
964189208 3:153982236-153982258 AATGGACACCAAAAGGGGGCAGG + Intergenic
964252950 3:154741203-154741225 AATGGACACCAAAAGCAGGCAGG + Intergenic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966165249 3:177009433-177009455 CTGGGACACAAAAAGGACATTGG + Intergenic
966499559 3:180624240-180624262 CATGGAAACCAAAAGCAAGTAGG - Intronic
966968602 3:185020708-185020730 TTGGGAGGCCAAAAGGAGGTTGG - Intronic
967600691 3:191384820-191384842 TGGGAACACCAAAAGGAGGGAGG - Intronic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
971229556 4:24789951-24789973 CAGGAACACTATGAGGAGGTGGG + Intronic
972534546 4:39988811-39988833 TAGGGACTCCAAAAGGAGAGAGG - Intergenic
976362282 4:84194419-84194441 CAGGGACTCCAAAAGCTGGGAGG + Intergenic
976587981 4:86820056-86820078 GAGGGACACCAAAAGGATGAGGG - Intergenic
976931510 4:90571581-90571603 CAGAGACTCCAAAATGAGGGAGG + Intronic
980860876 4:138498173-138498195 CATGGACACCAAAAGCAAGCAGG - Intergenic
981667266 4:147243876-147243898 CAGGCAGACCAAGAGGAGGGAGG - Intergenic
982643916 4:157998177-157998199 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
982829948 4:160046492-160046514 AATGGACACCAAAAGCAAGTAGG + Intergenic
983124722 4:163936637-163936659 CAGAGATACCAAAAGCAGATGGG - Intronic
983195059 4:164797888-164797910 TAGGGACAACAAAAGGTGGGAGG - Intergenic
983214632 4:164991774-164991796 CAAGGGAACCAAAAAGAGGTTGG - Intergenic
983277648 4:165637574-165637596 AAGGGACACCAAAAGCAAGCAGG + Intergenic
985997612 5:3605568-3605590 AAGGGACACCTAAAGGTGGGTGG - Intergenic
986667400 5:10115380-10115402 CAGAGACTCCAAAAGGTGGGAGG + Intergenic
986758799 5:10861286-10861308 CAGGGCCACAGAAAGGAGGAGGG + Intergenic
987315059 5:16716377-16716399 CAGGGACACCAAGAGCAGGGAGG + Intronic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987577922 5:19754331-19754353 AATGGACACCAAAAGGAAGCAGG + Intronic
988458542 5:31410985-31411007 CAGGGACACCAAAATAAGTGAGG + Intronic
988603867 5:32663921-32663943 AAGGGCCACCAAAAAGAGATGGG - Intergenic
989522338 5:42417042-42417064 CAGGTACACCAATAAGACGTAGG + Intergenic
991041461 5:62180199-62180221 CTGGGACTCCAAAAGGGGGGAGG + Intergenic
991208796 5:64080857-64080879 TAGGGACACCAAAAGGAGGATGG - Intergenic
991231063 5:64332878-64332900 TACCTACACCAAAAGGAGGTTGG + Intronic
992004125 5:72461146-72461168 CGGGAACAGCAAAGGGAGGTTGG + Exonic
992303402 5:75408610-75408632 TAGGGACTCTAAAAGGAGGAAGG + Intronic
992890328 5:81198269-81198291 TGGGGACTCCAAAAGGAGGGAGG - Intronic
994047456 5:95325924-95325946 TGGGGACTCCAAAAGGGGGTAGG - Intergenic
994304238 5:98182555-98182577 AATGGACACCAAAAGCAAGTAGG + Intergenic
995735075 5:115291820-115291842 CATGGACACCAAAAGGCAGAGGG - Intronic
995831649 5:116361407-116361429 CAGGGGCAACCCAAGGAGGTGGG + Intronic
996313740 5:122137694-122137716 AAGGGAGAGCAAAAGGAGATAGG + Intronic
996694720 5:126381509-126381531 AATGGACACCAAAAGTAAGTAGG - Intronic
996963692 5:129282386-129282408 TAGGGACTCCAAAAGGGGATAGG - Intergenic
997429065 5:133824981-133825003 CAGGGACACCAGGAAAAGGTGGG - Intergenic
998059834 5:139111269-139111291 AAGGGACACAGAAAGGTGGTAGG - Intronic
1000100928 5:158015480-158015502 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
1000394845 5:160762883-160762905 AATGGACACCAAAAGCAAGTAGG + Intronic
1001673248 5:173491651-173491673 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
1001882270 5:175254719-175254741 CATGGACACAGAAAGAAGGTGGG - Intergenic
1001936470 5:175709219-175709241 AAGGGACAGAAAAGGGAGGTCGG - Intergenic
1003498915 6:6687811-6687833 CAGGGACCCCAAAAGGAAGGAGG - Intergenic
1003661842 6:8069607-8069629 AAGGGAGGCCAAAAGAAGGTAGG - Intronic
1003826209 6:9955097-9955119 CAGGGACTCCAAAAGGACAGAGG - Intronic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1007121120 6:39382322-39382344 CAGAGACTCCAAAAGGAGGTAGG - Intronic
1007338246 6:41170864-41170886 AAGGGACATCAAAAGGAGCTTGG + Intergenic
1008171891 6:48218011-48218033 AATGGACACCAAAAGCAAGTAGG + Intergenic
1008258835 6:49339713-49339735 CAAGGACACCTAAAGGAAGAGGG - Intergenic
1008438773 6:51508050-51508072 CAGGGACTTCAAAAGCAGGGAGG + Intergenic
1008781441 6:55110546-55110568 AATGGACACCAAAAGCAAGTAGG + Intronic
1009349211 6:62653170-62653192 CAGGGACCCCAAAAGAACATGGG + Intergenic
1010141282 6:72617846-72617868 CAGGGATGCAGAAAGGAGGTGGG - Intergenic
1010500701 6:76595825-76595847 AATGGACACCAAAAGCAAGTAGG + Intergenic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1010628489 6:78168364-78168386 CACAGACACCAAAAGGAATTCGG - Intergenic
1011995901 6:93588054-93588076 TAGGGACTCCAAAAGGGGGAAGG + Intergenic
1013180312 6:107711848-107711870 CAGGCACATTAAAAGGAGGAAGG - Intronic
1016890075 6:148997069-148997091 CGGGGACTCCAAAAGCAGGGAGG - Intronic
1016934737 6:149441263-149441285 CCAGGAGCCCAAAAGGAGGTGGG + Intergenic
1017214740 6:151897502-151897524 AATGGACACCAAAAGCAAGTAGG - Intronic
1019972305 7:4550773-4550795 TAGGGACTCCAAAAGCAGGGAGG + Intergenic
1021167510 7:17359489-17359511 CAGTGACACAGAAAGTAGGTTGG - Intergenic
1022052213 7:26687393-26687415 ACGGGACACAAAAATGAGGTTGG - Intronic
1022112715 7:27241226-27241248 TAGGGACACAGAAAGGAGGGAGG + Intergenic
1024327808 7:48125333-48125355 AATGGACACCAAAAGGGAGTAGG - Intergenic
1024929389 7:54654040-54654062 GAGGGACACCATGAGGTGGTTGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027113004 7:75455675-75455697 CGGGGACCCCAAAGGGAGGGTGG - Intronic
1027285251 7:76640286-76640308 CGGGGACCCCAAAGGGAGGGTGG - Intergenic
1027578086 7:79956318-79956340 TAGGGACTCCAAAAGGAGGGAGG + Intergenic
1028822737 7:95231077-95231099 AATGGACACCAAAAGCAAGTAGG + Intronic
1028904923 7:96142283-96142305 CAAAGACACCAACAGGAGGAAGG - Intronic
1028936666 7:96472559-96472581 AATGGACACCAAAAGCTGGTAGG - Intergenic
1030512696 7:110503948-110503970 CAATGATACCAAAAGGAGGGAGG - Intergenic
1030816444 7:114044925-114044947 ATGAGACACCAAAGGGAGGTAGG + Intronic
1031876729 7:127150307-127150329 CAGGGACTTCAAAAGGAGGCTGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032361197 7:131256786-131256808 CAGGGACTCCAAAAGGGTGGAGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1036116872 8:5968459-5968481 CAGGCACATGAAAAGGAAGTTGG - Intergenic
1037129551 8:15391002-15391024 TAGGGACTCCAAAAAGAGGGAGG + Intergenic
1038362881 8:26900518-26900540 CAGGGACAGCAAGAGAAGCTAGG - Intergenic
1039825774 8:41173040-41173062 CAAGGTCACCAGAAGGACGTGGG - Intergenic
1039836402 8:41259605-41259627 TGGGGACTCCAAAAGGAGGAAGG + Intergenic
1041208756 8:55525043-55525065 CAGGTACACAAAGAGGAAGTGGG + Exonic
1043598483 8:81912460-81912482 CGGGGACTCCAAAAGGAAGGAGG - Intergenic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1044292084 8:90484160-90484182 AATGGACACCAAAAGCAGGCAGG + Intergenic
1044935822 8:97292599-97292621 CAAGGAATTCAAAAGGAGGTAGG - Intergenic
1045414395 8:101952071-101952093 CAGGGATTCCAAGAGGAGCTTGG - Intronic
1045729447 8:105218293-105218315 CAGGGACATGAAAAGGAGGGAGG + Intronic
1045894035 8:107192774-107192796 CAGGGGCAGCAAGATGAGGTAGG + Intergenic
1046400103 8:113694081-113694103 CATGGAAGCCAGAAGGAGGTGGG - Intergenic
1046669043 8:117037390-117037412 CAGGATCACCAAAAGGTGCTAGG - Intronic
1047287349 8:123499025-123499047 CAGCCACACCAAAAGGTGCTTGG + Exonic
1047447724 8:124934410-124934432 TGGGGAAACCAAAAGGAAGTAGG + Intergenic
1047752282 8:127890902-127890924 TAGGGAGACCCAAAGGAAGTTGG - Intergenic
1048331078 8:133471151-133471173 CAGGGAAACCAACAGCAGCTGGG - Intronic
1049822824 8:144646502-144646524 CAGGGACACCAAAAGACAGGAGG + Intergenic
1052006465 9:23355766-23355788 AATGGACACCAAAAGGAAGCAGG - Intergenic
1053004343 9:34594122-34594144 CAGGGGCACCATTAGGAGGGGGG + Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053477650 9:38393614-38393636 TGAGGAGACCAAAAGGAGGTAGG - Intronic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054947703 9:70813505-70813527 TAGGGACTCCAAAAGGAGGCAGG + Intronic
1056753605 9:89368587-89368609 CAGGGGCCCCAAGAGGAGGGAGG + Intronic
1056913512 9:90725202-90725224 CAGGGACACTCACAGCAGGTGGG + Intergenic
1059603904 9:115812391-115812413 TAGGTACACCATAATGAGGTAGG + Intergenic
1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG + Intergenic
1062372866 9:136249179-136249201 CTAGGACACCATGAGGAGGTGGG + Intergenic
1186044605 X:5521489-5521511 TGGGGATTCCAAAAGGAGGTGGG + Intergenic
1187133195 X:16522418-16522440 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
1188081222 X:25843252-25843274 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
1189130124 X:38489896-38489918 CAGGGAGACCAAAACAAAGTGGG + Intronic
1189176360 X:38961604-38961626 CGAGGACACCAAAAGGTGGTGGG - Intergenic
1189252248 X:39610375-39610397 CAGGGACAACAAAAGAAGTAGGG - Intergenic
1189845304 X:45131156-45131178 AAAGGCCTCCAAAAGGAGGTAGG + Intergenic
1191606402 X:63067165-63067187 CAGGTACACCAAACAAAGGTAGG - Intergenic
1193328314 X:80207625-80207647 CAGGGAGAGAACAAGGAGGTGGG - Intergenic
1194401954 X:93448647-93448669 TAGGGGCCCCAAAAGGAGTTGGG - Intergenic
1195408066 X:104538855-104538877 CAGGCACACTATAAGGACGTGGG + Intergenic
1195689217 X:107610184-107610206 AAGGGACCCCAAGAGGAGATGGG + Intergenic
1195985734 X:110627831-110627853 CAGGTACACCAAAAAAATGTAGG - Intergenic
1196145635 X:112313918-112313940 AAGGGAGATCAAAAGGAAGTGGG + Intergenic
1196970986 X:121108419-121108441 TAGGGACTCCAAAAGGAGGGAGG - Intergenic
1202117460 Y:21483550-21483572 AAAGGACACCAAGTGGAGGTGGG - Intergenic