ID: 1053062633

View in Genome Browser
Species Human (GRCh38)
Location 9:35043953-35043975
Sequence GATGCTGGTGGGACACATTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053062633_1053062639 -5 Left 1053062633 9:35043953-35043975 CCTGAATGTGTCCCACCAGCATC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1053062639 9:35043971-35043993 GCATCTGAGACACCATGGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 159
1053062633_1053062636 -10 Left 1053062633 9:35043953-35043975 CCTGAATGTGTCCCACCAGCATC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1053062636 9:35043966-35043988 CACCAGCATCTGAGACACCATGG 0: 1
1: 0
2: 0
3: 23
4: 248
1053062633_1053062641 20 Left 1053062633 9:35043953-35043975 CCTGAATGTGTCCCACCAGCATC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1053062641 9:35043996-35044018 TGCAAAGTAGAGAAAATATTTGG 0: 1
1: 0
2: 1
3: 60
4: 516
1053062633_1053062638 -6 Left 1053062633 9:35043953-35043975 CCTGAATGTGTCCCACCAGCATC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1053062638 9:35043970-35043992 AGCATCTGAGACACCATGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 220
1053062633_1053062642 21 Left 1053062633 9:35043953-35043975 CCTGAATGTGTCCCACCAGCATC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1053062642 9:35043997-35044019 GCAAAGTAGAGAAAATATTTGGG 0: 1
1: 1
2: 10
3: 77
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053062633 Original CRISPR GATGCTGGTGGGACACATTC AGG (reversed) Exonic
900666290 1:3817627-3817649 TGTGCCGGTGGGCCACATTCTGG - Intronic
901641038 1:10693210-10693232 GAGGCAGGTGGGAGACAGTCCGG + Intronic
902652436 1:17845367-17845389 GATGGGGGTGGGCCACATTTTGG + Intergenic
903070060 1:20722640-20722662 GATGGGGGTGAGGCACATTCAGG + Intronic
909158585 1:72114693-72114715 AATGGTGTTGGAACACATTCCGG + Intronic
912115269 1:106398955-106398977 GATGCTGGTAATACACATTTTGG - Intergenic
913515864 1:119605239-119605261 GGTGCTGGAAGGAGACATTCTGG + Intergenic
915148333 1:153808971-153808993 GAGGCTGGGGGTACACAATCAGG - Exonic
918761127 1:188410238-188410260 GATGCTGGGGAGACACTATCTGG + Intergenic
919775911 1:201193947-201193969 GAATCTGGTGGCACACACTCTGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
923518733 1:234719954-234719976 GATCCCGGTGGTACACACTCGGG - Intergenic
1065719473 10:28612460-28612482 GATTCTGCTGGGACAAATACAGG - Intronic
1067753148 10:48985085-48985107 GACTCTTGTGGGGCACATTCTGG - Intergenic
1067903454 10:50265940-50265962 GTTGTTGGTGGTACATATTCAGG + Intergenic
1073059707 10:100726140-100726162 GATCCTGATGGGCCACATGCAGG - Intergenic
1074601528 10:114918604-114918626 GAGTCTGGTGGGAGAAATTCAGG + Intergenic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076809503 10:132879237-132879259 TATGCTGATGGGAACCATTCAGG + Intronic
1077560493 11:3257424-3257446 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077566389 11:3303241-3303263 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077907310 11:6544532-6544554 AATGCTGGTGGGAAACACTAGGG - Intronic
1081617251 11:44598168-44598190 GATTCTGGTGGGAGACACTGGGG + Intronic
1082773101 11:57224044-57224066 GATGTTGGTGGGTCACATTAGGG - Intergenic
1083643477 11:64158349-64158371 GAGGCTGCTGGGACCCATTCTGG + Intronic
1088652652 11:111972093-111972115 GAAGCAGGTGGTACACATGCAGG - Intronic
1090077579 11:123589075-123589097 GCTGCTCATGTGACACATTCCGG - Intronic
1091701303 12:2665166-2665188 GATGCTGGTGGAGCTCACTCTGG - Intronic
1092322848 12:7496812-7496834 GATGCTGGCGTGACATGTTCTGG - Exonic
1094061938 12:26323570-26323592 TCTGCAGGTGAGACACATTCTGG - Intergenic
1099302986 12:80921023-80921045 CATTTTGGAGGGACACATTCAGG - Intronic
1099886909 12:88542720-88542742 GATGCTAGTTGGAAACATTAGGG + Intronic
1102408230 12:112692923-112692945 GATGCTGATGGGAATCATTTGGG + Intronic
1104290052 12:127458191-127458213 GATTCAGGAGGGACACATGCAGG + Intergenic
1104532585 12:129586365-129586387 TGTGCTTGTGGGACAAATTCAGG + Intronic
1104681007 12:130751899-130751921 GATGCTGCTCAGACACATTGGGG - Intergenic
1105463017 13:20609195-20609217 GATGCCTGTGTGACACATTTGGG + Intronic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1107668643 13:42719223-42719245 GGTGCCTGTGGGACACATGCAGG + Intergenic
1109647959 13:65285265-65285287 CATGCTGGTGGGAAACACTATGG - Intergenic
1111588538 13:90312670-90312692 GAAGCTGGTGGGGCACATTTGGG + Intergenic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1119630324 14:76226530-76226552 CATTTTGGAGGGACACATTCAGG - Intronic
1120224247 14:81772631-81772653 GATGGGGGTGGGACTAATTCAGG + Intergenic
1126925160 15:53577084-53577106 GATGCTGTTAGGACACAGCCAGG + Intronic
1129604128 15:77016508-77016530 GAGGCTGGGGGGACAGCTTCTGG + Intronic
1131865702 15:96707014-96707036 TATGCAGGGGGCACACATTCTGG + Intergenic
1131948599 15:97655103-97655125 GATCCTGCTGAGACACATTAGGG + Intergenic
1131983203 15:98016296-98016318 TATGCTGATGGGATTCATTCTGG - Intergenic
1132653388 16:1031499-1031521 GATGCTGCTGAGACAACTTCAGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134225319 16:12385534-12385556 GAGGCTGCAGGGACACAGTCCGG - Intronic
1137421460 16:48338432-48338454 CATGCTGATGGGAAACATTTGGG + Intronic
1137983349 16:53088214-53088236 GATGCTCATGGGACCCAATCAGG - Intronic
1139400033 16:66674127-66674149 GATGCAGTTGGGTCACAGTCTGG + Intronic
1140844088 16:78870211-78870233 GATTCTGTTGATACACATTCAGG + Intronic
1141708180 16:85681251-85681273 GATGCTGGTGGCTCACACTGGGG + Intronic
1141912675 16:87070751-87070773 GGTGGTGGTGGGACAAACTCAGG + Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1147137096 17:38440760-38440782 GATCCCGGTGGGACACACACTGG - Intronic
1160919586 19:1513403-1513425 GACGCCGGTGGGACGCAATCCGG - Intronic
1161428133 19:4215862-4215884 GGTGCTCGTGGGAGACATACAGG + Intronic
1161465586 19:4428568-4428590 GGTGCTGGTGGGATTCATCCAGG - Intronic
1163918522 19:20265384-20265406 GGACCTGGTGGGACACATTTGGG - Intergenic
925455852 2:4016054-4016076 GTTGCTGGTGTGACTCAGTCTGG + Intergenic
926902260 2:17765534-17765556 GATACTGCTGGGAGACATTTTGG + Intronic
927899567 2:26809485-26809507 TATCCTGGGGTGACACATTCTGG - Intergenic
928515304 2:32039420-32039442 GATGCTGGAGGGACAAACGCAGG - Exonic
929176902 2:38987486-38987508 GATTCTGCTGGGGCAGATTCTGG + Exonic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932715058 2:74094670-74094692 GGTGCTGATGGGACAGATTTTGG + Intronic
936350813 2:111711189-111711211 GGTGATGGGGGGACACATTTTGG - Intergenic
936918067 2:117660295-117660317 TATGCAGGTTGAACACATTCGGG + Intergenic
937687667 2:124716274-124716296 GATGATGGTGCCACACATTTAGG - Intronic
942008009 2:171727866-171727888 GTTGTTGGTGGTACATATTCAGG + Exonic
942704517 2:178755072-178755094 GAAGCTGGTGGAATAAATTCAGG - Intronic
946183211 2:217961188-217961210 GATGGTGGTGGGAAACCCTCTGG - Intronic
947590532 2:231382742-231382764 GATGAGGGTGGGAGAGATTCAGG - Intergenic
948497081 2:238357753-238357775 GAGCCTGGAGGGACACATTCAGG - Intronic
1168779985 20:480741-480763 TTTGCTGGTGGGACAAAATCAGG + Intronic
1169859696 20:10138299-10138321 GAAGCTAGTGGAACCCATTCTGG - Intergenic
1170912977 20:20593218-20593240 GATGCTGGTGGGAAACTGTTTGG + Intronic
1172486629 20:35302275-35302297 GATGCTGGAGGGACTCACCCAGG + Intergenic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1172794890 20:37529862-37529884 GATGGTGGGAGGCCACATTCAGG - Intergenic
1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG + Exonic
1175403873 20:58714988-58715010 GCTGCTGGCTGGACACGTTCAGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179171761 21:38978428-38978450 GATGCAGGGGGTACACATTCAGG + Intergenic
1179924989 21:44529398-44529420 GATGATGGTGGGACAGAGGCGGG + Intronic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1183949308 22:41343783-41343805 GAGGCAGGTGGGACACATTTGGG + Intronic
949763482 3:7499230-7499252 GTTTCTGCTGGGACACTTTCTGG - Intronic
949873136 3:8606408-8606430 AATATTGGTGGGACACATTCAGG + Intergenic
950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG + Intronic
953851080 3:46465879-46465901 GGTGCCTGTGGGACACATTGGGG + Intronic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
954346131 3:50001120-50001142 AATGCTGATTGGACATATTCAGG + Intronic
957945991 3:87063617-87063639 CATGTTGCTGGGACCCATTCTGG - Intergenic
958622862 3:96583988-96584010 GATGCAGGTGGGAGCCATTCAGG - Intergenic
960965469 3:123101331-123101353 GATGCTGGTGCCACTGATTCAGG + Intronic
964570184 3:158102597-158102619 GAGGCTTGGGGGACACACTCGGG - Intronic
969522342 4:7685809-7685831 GCTGCAGGAGGGACACAGTCAGG - Intronic
969655639 4:8496411-8496433 GATGGTGGTGGAACACCTGCTGG + Intergenic
970498959 4:16657318-16657340 GATGATGATGGGACTGATTCTGG - Intronic
970604950 4:17670876-17670898 GATGCTGGTAGGTGACAATCAGG - Intronic
971894847 4:32579311-32579333 GATTCTAGGGGGACACACTCTGG - Intergenic
975900124 4:79141413-79141435 GATGCTGGTGGGAGGCACTTGGG + Intergenic
979128582 4:117009493-117009515 GATACAGGGGGTACACATTCAGG - Intergenic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
992782493 5:80140852-80140874 GCTGCTGGTCAGACACATTTAGG - Exonic
995807905 5:116075015-116075037 GATGATTATGGGACAGATTCTGG - Intergenic
997447657 5:133953195-133953217 GAAGTTGCTGGGACAGATTCTGG - Intergenic
1001214166 5:169839817-169839839 GAGGCTGGAGGGACAAATTGAGG - Intronic
1005661092 6:28000495-28000517 GATGCTGGTGAGACCCAGTAAGG + Intergenic
1006555968 6:34867233-34867255 GATCCTGGTGGAACAGATTCTGG - Exonic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1007977410 6:46115396-46115418 GAATCTGGTAGGACACATCCTGG + Intergenic
1016531018 6:145058250-145058272 GATGCTGGTGGGAGCCCTGCAGG - Intergenic
1020107621 7:5429420-5429442 GAGGCTGCTGGGCCACATTCCGG + Intergenic
1022531592 7:31070225-31070247 GATGCTGGCTGGTCTCATTCTGG - Intronic
1022797816 7:33746139-33746161 GATGTTGGTATGACTCATTCAGG - Intergenic
1023899229 7:44462356-44462378 GATGCTAGTGGCACACATTATGG - Intronic
1024004880 7:45217800-45217822 GGGGCTAGTGGGACAAATTCTGG + Intergenic
1032062091 7:128733441-128733463 GTTGCTGGTGTGACATATTTGGG - Intergenic
1034713771 7:153220270-153220292 GATGCTGGTGGTCCACTTACAGG + Intergenic
1035016014 7:155766634-155766656 GATGTCAGTGGGACCCATTCAGG + Exonic
1035412530 7:158656596-158656618 GGGGCAGGTGGGGCACATTCTGG - Exonic
1037960182 8:23091924-23091946 GGTGCTGGAGGGAAATATTCTGG + Intronic
1040017718 8:42713337-42713359 GATTCTGGTGGCACACTTTGTGG - Intronic
1041795726 8:61745844-61745866 GATTCAGGTGGTACACATGCAGG + Intergenic
1042131807 8:65594686-65594708 AATGCTGGTGGGATGGATTCAGG - Intergenic
1042768855 8:72356812-72356834 GCTGCTGGTGGAGTACATTCAGG + Intergenic
1046720492 8:117613404-117613426 GATCCTGGTGGGATTCATTATGG - Intergenic
1047791888 8:128211630-128211652 GATGCTGCTGGTATACCTTCAGG + Intergenic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1048769411 8:137879878-137879900 GATGTTGGAGGGGGACATTCTGG + Intergenic
1052774988 9:32724181-32724203 AATGCGGGTGGGACACAGTGGGG + Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1053869838 9:42479373-42479395 TATGGTGGTGGGACACGTTATGG + Intergenic
1057307430 9:93920440-93920462 GATGCTGGGGGAACAGATTCTGG + Intergenic
1058270670 9:102968056-102968078 GATGGTGGTGGGAGACAGACAGG - Intergenic
1058533456 9:105930217-105930239 AATGCTGGCAAGACACATTCTGG + Intergenic
1059275384 9:113092133-113092155 GAAGCTGATGGGTGACATTCAGG - Intergenic
1059941035 9:119360207-119360229 TTTGCTGCTGGGACACATTTTGG - Intronic
1060212613 9:121719809-121719831 GTTGCTGGTGGTTCACATTTTGG - Intronic
1060671315 9:125472125-125472147 GTGGCTGAGGGGACACATTCTGG - Intronic
1061582308 9:131545655-131545677 GGTGCTGGTGGGACAGGTACTGG + Intergenic
1203783336 EBV:113554-113576 GAAGCAGGTGGCACACATTACGG - Intergenic
1186128303 X:6439859-6439881 GATTCTGGGGGTACACATGCAGG + Intergenic
1187485013 X:19695027-19695049 GAAGCTGGAGGGAGACCTTCAGG + Intronic
1190254617 X:48753330-48753352 GATGCTGGAGGTGCACATTCAGG - Intergenic
1193769442 X:85571794-85571816 CATGCTGGTGGGGCAGCTTCGGG - Intergenic
1195037463 X:100982837-100982859 GATGATGCTGAGACACAATCAGG + Intronic
1196324649 X:114388894-114388916 TCTGATTGTGGGACACATTCTGG + Intergenic
1196433427 X:115652304-115652326 GTAGCTGGTGGGACACATTATGG - Intergenic
1201619058 Y:15934884-15934906 GATGCAGGGGGTACAAATTCAGG + Intergenic
1201977469 Y:19868536-19868558 CAGGCTGGTGGGAAACATTATGG + Intergenic