ID: 1053066461

View in Genome Browser
Species Human (GRCh38)
Location 9:35072505-35072527
Sequence GCCCGACGCCTCGCTGCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053066461_1053066464 5 Left 1053066461 9:35072505-35072527 CCACCGGCAGCGAGGCGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1053066464 9:35072533-35072555 ACGCTGGCTCCTGATCCGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 50
1053066461_1053066465 8 Left 1053066461 9:35072505-35072527 CCACCGGCAGCGAGGCGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1053066465 9:35072536-35072558 CTGGCTCCTGATCCGCGAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1053066461_1053066469 20 Left 1053066461 9:35072505-35072527 CCACCGGCAGCGAGGCGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1053066469 9:35072548-35072570 CCGCGAGGTGGCAGTGGCAGTGG 0: 1
1: 0
2: 1
3: 41
4: 594
1053066461_1053066467 14 Left 1053066461 9:35072505-35072527 CCACCGGCAGCGAGGCGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1053066467 9:35072542-35072564 CCTGATCCGCGAGGTGGCAGTGG 0: 1
1: 0
2: 1
3: 12
4: 82
1053066461_1053066470 26 Left 1053066461 9:35072505-35072527 CCACCGGCAGCGAGGCGTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1053066470 9:35072554-35072576 GGTGGCAGTGGCAGTGGCAGCGG 0: 2
1: 27
2: 90
3: 462
4: 2066

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053066461 Original CRISPR GCCCGACGCCTCGCTGCCGG TGG (reversed) Exonic