ID: 1053066867

View in Genome Browser
Species Human (GRCh38)
Location 9:35075195-35075217
Sequence GGTGGGCTGGGACACATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053066861_1053066867 -4 Left 1053066861 9:35075176-35075198 CCTTTCTCTTAAGTCTCCTGGTG 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG 0: 1
1: 0
2: 1
3: 3
4: 130
1053066857_1053066867 23 Left 1053066857 9:35075149-35075171 CCTCTATTTCTTCTTGTGTCCAC 0: 1
1: 0
2: 1
3: 21
4: 292
Right 1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG 0: 1
1: 0
2: 1
3: 3
4: 130
1053066858_1053066867 4 Left 1053066858 9:35075168-35075190 CCACAGTCCCTTTCTCTTAAGTC 0: 1
1: 0
2: 2
3: 32
4: 360
Right 1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG 0: 1
1: 0
2: 1
3: 3
4: 130
1053066860_1053066867 -3 Left 1053066860 9:35075175-35075197 CCCTTTCTCTTAAGTCTCCTGGT 0: 1
1: 0
2: 2
3: 22
4: 350
Right 1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG 0: 1
1: 0
2: 1
3: 3
4: 130
1053066856_1053066867 26 Left 1053066856 9:35075146-35075168 CCTCCTCTATTTCTTCTTGTGTC 0: 1
1: 0
2: 1
3: 40
4: 560
Right 1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG 0: 1
1: 0
2: 1
3: 3
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053066867 Original CRISPR GGTGGGCTGGGACACATTAA AGG Intronic
904173932 1:28611950-28611972 GGTGGTCTGCTACACATTAATGG + Intronic
905284106 1:36868164-36868186 GGTGGGGTGGGGCACATTCCAGG - Intronic
905284511 1:36870557-36870579 GGTGGGCTGTGACTCTTCAAAGG - Intronic
905418302 1:37820084-37820106 GGCGGGCTGGGTCACAATACTGG + Intronic
906266921 1:44438648-44438670 GGTGGCCTGTGACCCATTTAAGG + Intronic
906669796 1:47646042-47646064 GAAGGGCTGGGACAAATTAAGGG + Intergenic
907708353 1:56852638-56852660 AATGGGCTGGGACTCATTTATGG + Intergenic
908667489 1:66509652-66509674 CGTGGGCTGGGACTCATTCCTGG + Intergenic
915814239 1:158949936-158949958 TTTGGGCAGGTACACATTAAGGG + Intronic
921208420 1:212870143-212870165 GGAAGGCTGGTACACATAAAAGG - Intronic
1064376688 10:14802776-14802798 GGTGGGGAGGGAAATATTAAAGG - Intergenic
1065448113 10:25823775-25823797 GGTGAACTAGGAGACATTAACGG + Intergenic
1066990243 10:42506296-42506318 GAAGGGATGGGCCACATTAAAGG + Intergenic
1068166187 10:53335825-53335847 GATGGGATGGGCCAAATTAAAGG + Intergenic
1070640868 10:78168975-78168997 GGTGGGCAGGTACAAAATAAGGG - Intergenic
1071106038 10:82096089-82096111 GGTGGGCAGGAACAAATTGATGG + Intronic
1072549315 10:96465438-96465460 GGTAGGATGGGACACAGAAAAGG - Intronic
1077962371 11:7089353-7089375 GGTGGCCTGGGCCACCTTGATGG - Exonic
1078454002 11:11461016-11461038 GGTGGGCTAGGACTCAGGAAGGG + Intronic
1080222264 11:29919856-29919878 GGTGTGCTGGCACACATCTATGG + Intergenic
1080268891 11:30429555-30429577 GGTTGGCTGGCACACAGTGAGGG - Intronic
1081732238 11:45379766-45379788 TGTGGCTTTGGACACATTAATGG - Intergenic
1082728933 11:56771483-56771505 GATGAGATGGGACACATTCAGGG - Intergenic
1084881225 11:72172965-72172987 TGTGGGCTGGCACACAATTAAGG - Intergenic
1085331715 11:75657447-75657469 GGAGGGCTGGGAAATATTACTGG + Intronic
1094563538 12:31578717-31578739 GCTGGGTGGTGACACATTAATGG - Intronic
1102992982 12:117327978-117328000 GGTGGGCTGTGACAGACTGAGGG + Intronic
1104997809 12:132669720-132669742 GATGGGCTGGGACAAGTGAATGG + Intronic
1105902652 13:24769483-24769505 GGTGAGCTGGGCCCTATTAAAGG + Intronic
1107625974 13:42284492-42284514 AGTGGCCTGGGACAAATAAAAGG + Intronic
1114055300 14:18963198-18963220 GGTGGGCTCAGACACTCTAATGG - Intergenic
1114107245 14:19438578-19438600 GGTGGGCTCAGACACTCTAATGG + Intergenic
1117465084 14:55984936-55984958 GCTGGGCAGGGGCACAATAAAGG + Intergenic
1120860440 14:89250535-89250557 GTTGGTCTGGGAGACATCAAAGG - Intronic
1121606951 14:95247549-95247571 GGTTGGCTGGGTCAGAGTAAAGG - Intronic
1126054372 15:44715798-44715820 GATGGGATGGGACTCATTCAGGG - Intronic
1129846374 15:78769470-78769492 GGGGGTCTGGGACACAGTACTGG + Intronic
1132634298 16:935906-935928 GGTGGGCGGGGACAGAGTACTGG + Intronic
1132851281 16:2026186-2026208 GGTGGGCTGGGACACAAGTGAGG + Intronic
1136079699 16:27843780-27843802 GGTGGGCTTGGTCAAACTAAGGG + Intronic
1137044726 16:35644340-35644362 AGTGGACTGGGATACATAAAAGG - Intergenic
1137587813 16:49674635-49674657 GGTGGGGTGGGACAAAGTGAAGG + Intronic
1140787574 16:78357565-78357587 CGTGGTCTGGGACACATTTGTGG + Intronic
1144772700 17:17768835-17768857 GGTGGGCAGGGCCCCATTAGGGG + Intronic
1146911261 17:36649844-36649866 GGTGGGCTGGGACAGAATGTGGG + Intergenic
1148794334 17:50189945-50189967 GGTGGGCTGGGACCCAGGACGGG - Intronic
1156376694 18:36521255-36521277 GGAGGTCTTGGGCACATTAATGG - Intronic
1157113426 18:44842260-44842282 GGAGGGCTGGGACATGTGAAGGG + Intronic
1157845125 18:50996519-50996541 GGTGTGGTGGTGCACATTAAGGG - Intronic
1159062815 18:63533718-63533740 GGTGGGAGGGTACACATAAAGGG - Intergenic
1163222150 19:15929410-15929432 TGGGGGCTGGGAAACATCAAAGG - Intronic
1163862286 19:19748658-19748680 GGTGGACTGGGACAGGTTCATGG - Intergenic
1164148281 19:22526650-22526672 GGTAGGCTGGGACATATGGAAGG - Intronic
1167428866 19:49443067-49443089 GGTGGGCGGGGACAGATTCCGGG - Intergenic
928902010 2:36329626-36329648 AGGGGGCTGGGACATAGTAAAGG - Intergenic
929334079 2:40718844-40718866 GCTGGGCTGGGAGAAATCAAAGG - Intergenic
929420607 2:41785839-41785861 GATGGGCTGGGACACTTGAGTGG + Intergenic
929638942 2:43556345-43556367 GGTGGAAAGGAACACATTAATGG - Exonic
931426690 2:62178138-62178160 GATGAGCTGGGCCACATTTATGG - Intergenic
932617587 2:73244297-73244319 TGTGGGCTGGGACACAGCCAAGG - Intronic
937302378 2:120851264-120851286 CATGGGCTGGGCCACCTTAAGGG + Intronic
942093642 2:172517811-172517833 TTTGGGCAGGTACACATTAAGGG - Intergenic
942121495 2:172782300-172782322 GGTGGGCTGGGAGGGATAAAAGG + Intronic
943308037 2:186291271-186291293 GGTGGGATGGTAGACCTTAAAGG - Intergenic
1169525084 20:6415769-6415791 TCTGAGCTGGGACACATGAAAGG + Intergenic
1172163693 20:32885900-32885922 GGTGGGCAGGGACAGCTAAAGGG - Intronic
1172980439 20:38937569-38937591 TGAGGGCTGGGACACAGGAATGG + Intronic
1178879313 21:36435907-36435929 GGGAGGCTGGGACACAAGAATGG + Intergenic
1180473782 22:15685750-15685772 GGTGGGCTCAGACACTCTAATGG - Intergenic
1180839823 22:18954128-18954150 GGGGAGCTGGGACCCATTTAGGG + Intergenic
1181062072 22:20286351-20286373 GGGGAGCTGGGACCCATTTAGGG - Intergenic
1181309165 22:21934420-21934442 GGTGGGATGGGAGACTTCAAGGG - Intronic
1182347392 22:29675962-29675984 GGTGGGTTGTTACACAGTAACGG - Intronic
950020687 3:9785522-9785544 GGTGGGATGGGAAAGATAAAAGG - Intronic
950223977 3:11218528-11218550 GGTGGGATGGGACACATATGAGG + Intronic
950962968 3:17124378-17124400 GGTGTGCTGGGGCACAATCACGG - Intergenic
951172363 3:19556697-19556719 TGTGGGCTGGGACACTTAACAGG + Intergenic
952195800 3:31074213-31074235 AGGGAGCTGGGACACATGAATGG - Intergenic
952986688 3:38791878-38791900 TGGGGTGTGGGACACATTAAAGG + Intronic
953505764 3:43484417-43484439 GGAAGGCTTGGCCACATTAATGG + Intronic
956568886 3:70672028-70672050 TGTGGTCTGGGACTCATTCACGG - Intergenic
960890252 3:122440580-122440602 GGTTGGCTGGGATACAAGAAGGG - Intronic
961661063 3:128469074-128469096 GGTGGGCAGAGACAGATGAAAGG + Intergenic
963283080 3:143405671-143405693 GGTGGGATGGGAAACACTAGTGG + Intronic
966577450 3:181518600-181518622 GGTGGGATGGGAGGCATGAAAGG - Intergenic
970170131 4:13281201-13281223 GGTGGGCCCTGACACAGTAATGG - Intergenic
974451334 4:62065050-62065072 GGTGGGATGGGCCCCATTATAGG - Intronic
975627645 4:76365533-76365555 GATGGTGTGGGAGACATTAAAGG - Intronic
977037600 4:91975270-91975292 GGTGGACTTGGAGACAATAAGGG + Intergenic
979784488 4:124698473-124698495 GGTGGGCAGGGAGATATTAGAGG + Intronic
980084868 4:128380598-128380620 GGCTGGCTGGGTCACATTGAAGG - Intergenic
987513485 5:18874241-18874263 GATGGGCTGGGAACCATCAAAGG + Intergenic
991583782 5:68182523-68182545 TGTGGGGTGGGACAGATTCAAGG + Intergenic
992974147 5:82095674-82095696 GGTGGGCTAAGACACACTGAAGG - Intronic
994087562 5:95776943-95776965 GAAGGCCTGGGACACTTTAAAGG - Intronic
996900614 5:128538374-128538396 AGTGGGCGGGGACAGAGTAAGGG + Intronic
1000119467 5:158182924-158182946 GTTGGGCTGGGACATGTAAAGGG - Intergenic
1000829071 5:166081151-166081173 GGTGGGCTGGGGTGCATGAAAGG - Intergenic
1004497747 6:16180819-16180841 GGTGGGCTGGGACGCAGGCATGG + Intergenic
1010626210 6:78138794-78138816 TTTGGGCTGGTACACAGTAAGGG - Intergenic
1013826352 6:114215527-114215549 GGAGGGGTGGGACTCAATAAGGG - Intronic
1014259102 6:119195628-119195650 GGTGGACTGGGAAACATAATAGG - Intronic
1018893275 6:167997053-167997075 GGTGGCCTGGGCCACATTGGTGG + Intronic
1021566031 7:22017355-22017377 GGTGGCCTGGGACACAGCACAGG + Intergenic
1023875092 7:44282500-44282522 CGTGGGCTGGGACACACACATGG + Intronic
1025641565 7:63377618-63377640 GGTGGCCTGGAACACACTCAGGG - Intergenic
1026463076 7:70631726-70631748 GGTTGGCTGGGCCACAGCAAGGG + Intronic
1029365051 7:100111401-100111423 GGTGTGCAGGGACACAATCATGG + Intronic
1031413468 7:121467723-121467745 GCTGGGCATGGACATATTAAAGG + Intergenic
1031922760 7:127613731-127613753 GCTGGGCTGGGACAGATGGAGGG - Intronic
1035070955 7:156144458-156144480 TGTGGGCTGTCACACATAAAAGG - Intergenic
1037002583 8:13738045-13738067 GGGAGGATGGGACAAATTAAGGG - Intergenic
1037252587 8:16914100-16914122 GAAGGGCTGGGACACATTGAAGG - Intergenic
1038452757 8:27650427-27650449 GGTGGCATGGGACACAATGAAGG - Intronic
1041030658 8:53732789-53732811 GGTAGGCTGGGACATATGGAGGG - Intronic
1048756959 8:137750176-137750198 GGTGGACTGCGAAACATTGAAGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1049113450 8:140664855-140664877 ACTGGGCAGGGACACATTCAGGG - Intronic
1051046478 9:12881272-12881294 GGTGGGCTATAACATATTAATGG - Intergenic
1053066867 9:35075195-35075217 GGTGGGCTGGGACACATTAAAGG + Intronic
1053128826 9:35604335-35604357 GGAGGGCTGGGTCACACTGAGGG + Intergenic
1188813405 X:34681251-34681273 GGTGAGCTTGGACACATTTCAGG + Intergenic
1189303377 X:39969153-39969175 GGAGGCCTGGGACACACAAAAGG - Intergenic
1190329245 X:49225755-49225777 GGTGGGATGGGACAGGCTAAGGG + Intronic
1191087838 X:56588139-56588161 GGTGGGATGGGAGCCATGAATGG + Intergenic
1191158966 X:57306570-57306592 GGTTGGTTAGAACACATTAATGG - Intronic
1194104027 X:89745401-89745423 GGTGGGCTTTGACAAAGTAATGG - Intergenic
1195755797 X:108197560-108197582 GGTGAGCCAGGTCACATTAAAGG - Intronic
1195869779 X:109473780-109473802 GGTGGGATGTGAAACATTCATGG + Intronic
1197267230 X:124387921-124387943 AATGGGCTTGGAGACATTAAGGG + Intronic
1197525666 X:127559327-127559349 TGTGGACTGGGCCACATTACTGG + Intergenic
1199372467 X:147066963-147066985 GGTGGGCTGCGGCACAATGAAGG - Intergenic
1199640736 X:149858604-149858626 GGTGGGCTGGGACACTTTGATGG - Intergenic
1200455981 Y:3393207-3393229 GGTGGGCTTTGACAAAGTAATGG - Intergenic
1201392409 Y:13512868-13512890 CTGGGGCTGGGACACATTTATGG - Intergenic