ID: 1053069639

View in Genome Browser
Species Human (GRCh38)
Location 9:35093496-35093518
Sequence CCACAAATGGAGACCATGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053069639 Original CRISPR CCACAAATGGAGACCATGGA GGG (reversed) Exonic
900764833 1:4497827-4497849 CCACAGAGAGAGGCCATGGAAGG - Intergenic
902738131 1:18414695-18414717 CCACAAATGAACACTCTGGAGGG + Intergenic
902779027 1:18692802-18692824 CCATATATTGAGGCCATGGAGGG - Intronic
903107836 1:21099679-21099701 CCACAAAGGGACATCATTGAAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
910300764 1:85705166-85705188 GTGCAAATGGAAACCATGGAAGG - Intronic
914720931 1:150288255-150288277 GCAAAAATGAAGACCATGAATGG + Intergenic
917506133 1:175628794-175628816 CCACCATTGAAGACGATGGATGG - Intronic
923868600 1:237966330-237966352 CTAAAAAAGGAGAACATGGATGG + Intergenic
924799544 1:247317582-247317604 CCACCAGTGGAGACCATGTAGGG + Intronic
924918172 1:248596258-248596280 CCAAAAATGGAGTCCATTTAGGG + Intergenic
1063455988 10:6182955-6182977 CCACAGGTTGAGAACATGGATGG + Intronic
1064252917 10:13720642-13720664 GCACAAATGGGAACCAGGGAAGG + Intronic
1064265789 10:13824229-13824251 GCACTAAGGGAGACCAAGGAGGG + Intronic
1066641157 10:37555587-37555609 CCACAAATAGAATTCATGGAAGG + Intergenic
1068924138 10:62517251-62517273 CCACAAAGGGAGGTCAGGGAGGG + Intronic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1072818086 10:98529439-98529461 ACAAAAATGGAGAAGATGGATGG - Intronic
1072946564 10:99815942-99815964 CCAGAAATGGAGACCAACAAAGG - Intronic
1075711493 10:124533229-124533251 CCATAAACTGAGACCATTGAGGG + Intronic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1080193976 11:29585978-29586000 ACACACATGGAGGCAATGGAAGG + Intergenic
1080556911 11:33426450-33426472 CCATAAATTGAGAGCAAGGAGGG + Intergenic
1082882727 11:58053999-58054021 ACACAAATGGTGACTATGGGTGG + Intronic
1083187551 11:61026471-61026493 CAACAAAGGGAGACAAAGGAGGG + Intergenic
1083581928 11:63830509-63830531 CCACACCTGGATCCCATGGAAGG - Intergenic
1083606323 11:63981043-63981065 CCACAAATGCAGGACATGGCAGG - Intronic
1084330533 11:68427304-68427326 CCTCAGATGGTTACCATGGAGGG - Intronic
1084340923 11:68500328-68500350 CCACAAATGGAAGGCATGGTGGG - Intronic
1084498081 11:69517040-69517062 CTGCAAATGGAGACCAGGGAAGG - Intergenic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1086943832 11:92825537-92825559 GCACAAATGCAGACCAGGGAAGG + Intronic
1096262826 12:50103738-50103760 CCTCAAAATGAGACCATGGTGGG + Intergenic
1101450982 12:104778820-104778842 CAACAAATGAAGCCCATGCATGG + Intergenic
1107689950 13:42943592-42943614 TCCCAAAAGGAGAACATGGATGG + Intronic
1110390340 13:74966126-74966148 CCATAAGAGGAGAACATGGATGG - Intergenic
1113080939 13:106519000-106519022 CCACGGAAGGAAACCATGGAAGG + Intronic
1114210273 14:20608149-20608171 ACACAGCTGGAGACCATGCAGGG - Intronic
1115788595 14:36854809-36854831 CAACAAAAGGAAACCAGGGATGG + Intronic
1117355254 14:54917869-54917891 CCACAAATGGAAACCACCTATGG - Intergenic
1117503504 14:56377335-56377357 CCAGAAATAAAGCCCATGGAAGG - Intergenic
1118726756 14:68634364-68634386 CCACAACTGGAGACTGTTGAAGG - Intronic
1121947352 14:98136115-98136137 CCACAGCTGGAGACAATGGCAGG - Intergenic
1122048241 14:99038425-99038447 CCACAAATGCAGAGCATGATGGG + Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126841766 15:52724324-52724346 CCAGAAATGGAGAGCTTGAATGG - Intergenic
1127316549 15:57800177-57800199 ACACAGATGGTAACCATGGATGG - Intergenic
1127617654 15:60702841-60702863 CCACACAAGGTGACCATGGAAGG - Intronic
1128225084 15:65995930-65995952 CTATAAATGGAGATGATGGAAGG - Intronic
1128991881 15:72267575-72267597 CCACAAAGGGAGACAAGGTAGGG + Exonic
1134863215 16:17579501-17579523 CCAGGAAGGGAGACCATGGAGGG + Intergenic
1135379230 16:21980290-21980312 CCACAAATGGAGGCCAAAGTGGG + Intronic
1137397901 16:48129565-48129587 CCACAGCTGGAGAGCCTGGAGGG + Intronic
1140571697 16:76114353-76114375 ACACAAATGGTAACCATGTAAGG - Intergenic
1141628441 16:85273991-85274013 CCCCAAAAAGAGACCCTGGATGG - Intergenic
1144218641 17:13080128-13080150 CCTCAAATGGTGAACATGGCTGG - Intergenic
1147621919 17:41873797-41873819 CCAGAAAAGGTGAGCATGGAGGG - Exonic
1149369911 17:55983183-55983205 ACACAAACGGAGCCTATGGAGGG - Intergenic
1156581591 18:38382916-38382938 CCACAGATGGAGACTATGCATGG - Intergenic
1160124918 18:76163089-76163111 CCGCAAGTGGAGAGGATGGAAGG - Intergenic
1160779256 19:870698-870720 CCATGACTGGAGAACATGGAGGG + Intronic
1161079991 19:2305853-2305875 CCCCAAAAGCAGACCTTGGAGGG - Intronic
1162513774 19:11136155-11136177 CTAAAAATGGAGGCCAAGGAAGG + Intronic
1163134152 19:15297244-15297266 GCACAACTGGAGACCATGCCAGG - Intronic
1163484452 19:17577645-17577667 TCACAGTTGTAGACCATGGAAGG + Intronic
1164454988 19:28399498-28399520 CCACAAGTGGAGATCTGGGAAGG - Intergenic
1165283786 19:34820244-34820266 TCACAGATGGAAATCATGGAGGG + Intergenic
1165665231 19:37622220-37622242 CCACCAATGGAAAGCACGGAGGG - Intronic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1168275350 19:55274845-55274867 CCACAGAGGGACAACATGGAGGG + Intronic
925130835 2:1493019-1493041 CCACAGAGTCAGACCATGGACGG + Intronic
925174416 2:1772085-1772107 CCACAAGTGGGGACCATAGAGGG + Intergenic
929219762 2:39451084-39451106 ATACAAATAGAGACCATAGATGG + Intergenic
929297070 2:40260265-40260287 CCACAAAAGGGAACCAGGGAAGG + Intronic
933283246 2:80355887-80355909 CCAGCAATATAGACCATGGAAGG - Intronic
933308535 2:80632119-80632141 GTACAAATGGAGATTATGGATGG - Intronic
934487106 2:94725626-94725648 CCACAAGGGGAGACCATGTGTGG + Intergenic
936415655 2:112307725-112307747 CCACAAAAGGAGCCCTGGGATGG + Intronic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
939324614 2:140672167-140672189 TCAAAAATGGAGAAAATGGAAGG + Intronic
939844955 2:147231604-147231626 CCACACATGGAGAACACAGAAGG - Intergenic
940596158 2:155795606-155795628 CCCCAAATGGGGACTATGTATGG + Intergenic
940725631 2:157332727-157332749 CAAAAAATGGACACCAAGGATGG - Intergenic
941724250 2:168844205-168844227 ACAGAAATGGAGCCCATGGTGGG + Intronic
942797981 2:179843638-179843660 GCACAAATGAAGACAATGAATGG - Intronic
946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170035969 20:11990447-11990469 CCTCAAATGGAGTCCCAGGACGG + Intergenic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1171984500 20:31650256-31650278 CCACACAGAGTGACCATGGAGGG - Intergenic
1173834480 20:46116344-46116366 CCAGAAATTGAGAGCTTGGAGGG + Intergenic
1174105523 20:48159969-48159991 CCAGAAATGCAGAGCAGGGATGG + Intergenic
1175278188 20:57786106-57786128 CCAGAAAGGGAGTCCAAGGAGGG - Intergenic
1178165222 21:29966793-29966815 GCACAAAGGGAGAACATGGAGGG - Intergenic
1178365583 21:31986575-31986597 CCACACAGGGCGACCATGCACGG - Intronic
1179263275 21:39777564-39777586 CCAAAAATGGTGAAGATGGAAGG - Intronic
1180031214 21:45209592-45209614 TGACAAAGGGTGACCATGGAGGG - Intronic
1181878620 22:25959740-25959762 CAGCAAGTGGAGAACATGGAGGG + Intronic
1182818509 22:33190671-33190693 CCACAAATGCAGATCTTGGTGGG + Intronic
1183319743 22:37157670-37157692 CCAGAATTGGAGATCAGGGAAGG - Intronic
950247849 3:11438273-11438295 CCACCATTGGGGACCCTGGATGG - Intronic
951258568 3:20480299-20480321 CCACAAATGGTGACTATGGGTGG + Intergenic
951352015 3:21617920-21617942 CCACAAATGGAGAACTGGAAGGG - Intronic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952278013 3:31896475-31896497 CCACAACTGGATTCCAAGGAGGG - Intronic
953099575 3:39810946-39810968 CAACAAATCGAGATCATGGTCGG - Intronic
953756159 3:45647550-45647572 CCACCAATGGTGACCATTGCAGG - Intronic
957488961 3:80898520-80898542 GCAGAAATGGAGGCCATTGATGG - Intergenic
958033626 3:88145974-88145996 CTACAAATGTAGACCATGAGTGG + Intronic
958676177 3:97271899-97271921 ACACAAATGATAACCATGGAAGG - Intronic
959393540 3:105806017-105806039 CCCCATATGTAGACCATGGGAGG - Intronic
959960707 3:112294926-112294948 CCTCAGTTGGAGACCATGTAGGG - Intergenic
960931653 3:122856977-122856999 CTACAAATGGAGACCAAAAAAGG + Intronic
961435017 3:126910995-126911017 ACAAAAATGGAAAGCATGGAGGG - Intronic
962156275 3:132952160-132952182 CCACACAGGGATACCATGGCTGG - Intergenic
963327233 3:143876251-143876273 CCAGAAAGGGAGCCCATAGAGGG - Intergenic
963745321 3:149119240-149119262 CCAAAAATTGAGACTTTGGATGG + Intergenic
963943638 3:151120659-151120681 CCACATAAGGAAACAATGGAAGG + Intronic
964065285 3:152570424-152570446 CAAGAAATGGAGACCAGGCAGGG - Intergenic
967970439 3:194995095-194995117 CCACAAAGGGAGCCCTAGGAAGG - Intergenic
971175314 4:24277034-24277056 CCACAAATGAATACCTTTGAAGG - Intergenic
972702746 4:41509717-41509739 AAACAGATGGAGAACATGGAAGG + Intronic
975106285 4:70572153-70572175 GCATAAATGGAAACCATGGTAGG + Intergenic
981492348 4:145352988-145353010 CCACAAATGGAGCCAAAGGTTGG + Intergenic
982883217 4:160746311-160746333 ACACAAAGGGAGACGATTGAAGG + Intergenic
983499524 4:168483218-168483240 TCACAAAGGGAGAAAATGGAAGG - Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
986588428 5:9343600-9343622 CCAAAAATGAAGTCCATAGAAGG - Intronic
988099472 5:26658877-26658899 TCACAAATGGAGAGGAGGGAGGG - Intergenic
988746370 5:34142719-34142741 CCACAAATAAAGACCTTGTACGG + Intergenic
989691451 5:44149652-44149674 ACCCAAGTGGACACCATGGAAGG - Intergenic
991618517 5:68520882-68520904 CCACAAGGGGAGGCCATGGGTGG - Intergenic
992382013 5:76246920-76246942 ACAGAAATGGAAGCCATGGATGG + Intronic
997442841 5:133920872-133920894 CCACAAAAGGAGACCAGGGAAGG + Intergenic
1001771025 5:174295878-174295900 CCAGAGATGGAGACAAAGGATGG + Intergenic
1003862833 6:10337697-10337719 GCGCAACTGGAGCCCATGGAGGG - Intergenic
1009015307 6:57892583-57892605 CCACAAATAAAGACCTTGTACGG + Intergenic
1009475545 6:64086460-64086482 CTAAAAAGGAAGACCATGGAGGG - Intronic
1014430734 6:121367218-121367240 TCACATATGGAGGCCAAGGAGGG + Intergenic
1016724009 6:147339154-147339176 ACACAAATGAAGACAACGGAAGG - Intronic
1019268765 7:134198-134220 CCCAAAGTGGAGACGATGGAGGG + Intergenic
1020433521 7:8137575-8137597 ACAAAAATGGACACCATGTATGG + Intronic
1021392430 7:20109891-20109913 TCTCAGATGGATACCATGGATGG + Intergenic
1022894432 7:34735279-34735301 CTATGAATGGAGACCAGGGAGGG - Intronic
1023572355 7:41585242-41585264 CCAGAAATGGATCACATGGAAGG - Intergenic
1026383277 7:69820430-69820452 ACAGAATTGGAAACCATGGATGG + Intronic
1026538680 7:71261608-71261630 CGTGAAATGGAGACCCTGGAAGG + Intronic
1032627952 7:133613207-133613229 ACACAAATGCAGACCATATATGG + Intronic
1034869273 7:154669237-154669259 CTTGAAATGGATACCATGGAAGG + Intronic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1036797001 8:11763540-11763562 ACAAAAATGGGGACCATGGCAGG - Exonic
1037980515 8:23250086-23250108 CCACAGCTGGGGACCATGAAGGG - Intronic
1041757726 8:61332346-61332368 ACACAAGGGGAGTCCATGGAAGG - Intronic
1041907923 8:63053924-63053946 ACACAAAGGGAGAATATGGAGGG + Intronic
1042136648 8:65639003-65639025 CAAGAAATTGAGACCCTGGAAGG + Intergenic
1042655136 8:71087595-71087617 CCACAAAAGGTGAGTATGGAGGG - Intergenic
1044318209 8:90773820-90773842 TCAAAAATGGAGACTATGCATGG - Intronic
1046397413 8:113658175-113658197 CCACAATAGGAGAGCATGGTAGG + Intergenic
1046631145 8:116624096-116624118 CCACAAATCCAGACAACGGATGG + Intergenic
1050741563 9:8826345-8826367 GCACAATAGGAGACCATGGGAGG - Intronic
1051843939 9:21430351-21430373 CCACAGCTTGAGAACATGGAAGG + Intronic
1051906846 9:22105212-22105234 GCACATATGAAGACTATGGAGGG + Intergenic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1053206135 9:36188147-36188169 CCACAGATGGAGACTAGAGAGGG - Intergenic
1054820811 9:69518704-69518726 TTACAAATGGACACAATGGATGG + Intronic
1055883626 9:81032778-81032800 CCACAAAAGCAGACCCCGGACGG - Intergenic
1057247632 9:93470588-93470610 CCACACGTGGAGACCATACAAGG - Intronic
1057802369 9:98198185-98198207 CCATCACTGGGGACCATGGACGG - Intergenic
1058573925 9:106379750-106379772 CCAAAAAGGGAGACCTAGGAAGG - Intergenic
1058830314 9:108810588-108810610 CCAGAGTTGGAGACCTTGGAGGG - Intergenic
1062066471 9:134529968-134529990 CCAAAATTAGAGACCATGGATGG + Intergenic
1185966925 X:4616068-4616090 CCCCAAATAGTGAACATGGATGG - Intergenic
1187474745 X:19601085-19601107 CCATATATGAAGACTATGGAAGG - Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1194975468 X:100392055-100392077 CCTCAAGAGGAGATCATGGAAGG - Intronic
1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG + Intronic
1201553703 Y:15246250-15246272 GAACAAAGGGAGACCATGTATGG - Intergenic