ID: 1053069714

View in Genome Browser
Species Human (GRCh38)
Location 9:35093965-35093987
Sequence GGCCACAGTGGTCCACACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053069710_1053069714 7 Left 1053069710 9:35093935-35093957 CCATTTCAGGGTGGTGAGGGCCA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG 0: 1
1: 0
2: 1
3: 20
4: 236
1053069704_1053069714 28 Left 1053069704 9:35093914-35093936 CCATCTGGCTAAGTTTCTTGGCC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG 0: 1
1: 0
2: 1
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053069714 Original CRISPR GGCCACAGTGGTCCACACCC AGG Exonic
900352537 1:2242426-2242448 GGCCACGGTAGGCCACATCCCGG - Intronic
901939742 1:12652864-12652886 AGCCAGCTTGGTCCACACCCTGG + Intronic
902453587 1:16515415-16515437 AGCCAGCTTGGTCCACACCCTGG - Intergenic
902473642 1:16668079-16668101 AGCCAGCTTGGTCCACACCCTGG - Intergenic
902485161 1:16739363-16739385 AGCCAGCTTGGTCCACACCCTGG + Intergenic
902488620 1:16764491-16764513 GGCCACACTGGCCAGCACCCAGG - Intronic
902498895 1:16894847-16894869 AGCCAGCTTGGTCCACACCCTGG + Intronic
903482048 1:23660896-23660918 GGGCACCGTGGCTCACACCCAGG - Intergenic
904533589 1:31184425-31184447 GGGCACATGGGTACACACCCTGG - Intronic
905095313 1:35465142-35465164 GGCCACTGTCCTCCAGACCCTGG + Intronic
905250293 1:36644002-36644024 GGCCACAGTGGTCTTAGCCCAGG - Intergenic
906022227 1:42640086-42640108 TGCCACAGTGGTACAAACCTAGG + Intronic
906517998 1:46450840-46450862 GGCCACAGTGGGCCAGGCCAGGG + Intergenic
907646976 1:56254076-56254098 AGCCAGCTTGGTCCACACCCTGG + Intergenic
908882027 1:68743229-68743251 GGCCACTGTCCTCCAGACCCCGG + Intergenic
914005712 1:143730751-143730773 AGCCAGCTTGGTCCACACCCTGG - Intergenic
914098178 1:144561997-144562019 AGCCAGCTTGGTCCACACCCTGG - Intergenic
914300804 1:146375621-146375643 AGCCAGCTTGGTCCACACCCTGG + Intergenic
914517893 1:148389773-148389795 AGCCAGCTTGGTCCACACCCTGG - Intergenic
914806482 1:150995764-150995786 TGCTACAGTAATCCACACCCAGG + Intergenic
915037642 1:152942218-152942240 GCCCACAGGGGTCCACAGTCTGG - Intergenic
915891688 1:159779688-159779710 GGACACAGTGATCCAAGCCCAGG - Intergenic
918190059 1:182164912-182164934 GGCCAGAGGAGTGCACACCCTGG - Intergenic
918625044 1:186647945-186647967 GGGCACACTGGTAAACACCCTGG + Intergenic
921546971 1:216484544-216484566 AGCCAGCTTGGTCCACACCCCGG - Intergenic
922718182 1:227887564-227887586 GGCCAAAGGGGCCCACAGCCCGG - Intergenic
922792535 1:228318109-228318131 GGCCACAGTGGTACTCGCCCTGG - Exonic
923321282 1:232836092-232836114 AGCCACACTGTTCCACATCCTGG + Intergenic
923461826 1:234214964-234214986 AGGCACAGAGCTCCACACCCAGG - Intronic
923531819 1:234818025-234818047 GGCCACACTGGCCAGCACCCAGG + Intergenic
1062907383 10:1187847-1187869 GGACACATGGGACCACACCCTGG - Intronic
1063575850 10:7261369-7261391 GGCCAGAGTGTTACAAACCCTGG - Intronic
1063953131 10:11242744-11242766 GTCCACCCTGGTCCTCACCCTGG - Intronic
1064726032 10:18280872-18280894 GCACACAGTGGTTCATACCCAGG - Intronic
1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG + Intronic
1065020250 10:21496677-21496699 GGACACCGTGGTCCGCGCCCTGG + Intronic
1067028509 10:42864896-42864918 GCCCACTGTGGTCCACAGCCCGG + Intergenic
1069905575 10:71730392-71730414 GGCCACAGTGGGCCAAGCCCTGG + Intronic
1071218380 10:83433811-83433833 AGCCAGCTTGGTCCACACCCTGG + Intergenic
1074118716 10:110477318-110477340 GGCCACAGTGGTCCTGTCTCAGG + Intergenic
1075699166 10:124457609-124457631 GGGCACAGTGGCTCACACCTTGG - Intergenic
1075719780 10:124577911-124577933 GGCCACACTGGTCCCCACCTCGG + Intronic
1076868043 10:133178865-133178887 CGCCACAGTAGTCCTCACCTTGG + Intronic
1077324227 11:1956805-1956827 GGCCAGAGAGGGCCACACACAGG + Intronic
1077887596 11:6397184-6397206 TGCCTCTGTGGTCCACTCCCAGG + Intronic
1083211442 11:61189665-61189687 GACCACAGAGGGCCCCACCCTGG - Intergenic
1083592324 11:63903004-63903026 AGCCAAAGTGGTCTACAGCCAGG - Intronic
1083799574 11:65038720-65038742 GGCCACAGAGCTCATCACCCAGG + Exonic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1084793783 11:71491037-71491059 GGCCACCCTGGCCCACACTCAGG + Intronic
1085394117 11:76198032-76198054 GGACCCAGCGGTCCTCACCCAGG + Intronic
1087433371 11:98081326-98081348 GGCCACCATCCTCCACACCCTGG + Intergenic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1090687618 11:129140932-129140954 GGACACAGTGGTAGACACCTTGG - Intronic
1202807213 11_KI270721v1_random:12000-12022 GGCCAGAGAGGGCCACACACAGG + Intergenic
1093877603 12:24368945-24368967 GCCAACAGAGGTCCAAACCCTGG + Intergenic
1094385453 12:29888853-29888875 GGGAACAGTGGTCCACACATGGG + Intergenic
1097066205 12:56322683-56322705 GGCTACTGTGGTACACATCCTGG - Exonic
1099485279 12:83222414-83222436 GGCCCCACTGGTACAAACCCTGG + Intergenic
1102245452 12:111353049-111353071 TCCCACAGGGGGCCACACCCTGG - Intergenic
1102347149 12:112167566-112167588 GGGCACAGAGGCCCACGCCCAGG - Intronic
1102598568 12:114012117-114012139 GACCACAGTCCCCCACACCCCGG - Intergenic
1103093829 12:118117271-118117293 AGCCAGCTTGGTCCACACCCTGG - Intronic
1103178276 12:118884165-118884187 GACCACAGTGGTCCACACTGAGG - Intergenic
1105018730 12:132802397-132802419 GGGCACAGGGGTGCACGCCCAGG + Intronic
1105307567 13:19179970-19179992 GGTCACTGTGGTCCAAGCCCAGG + Intronic
1105383647 13:19910616-19910638 GGGCACGGTGGTTCACGCCCGGG - Intergenic
1106641989 13:31594138-31594160 TTCCACAGTGCTCCACACCAGGG - Intergenic
1111081895 13:83321995-83322017 GGCCACTGTCTTCCAGACCCCGG - Intergenic
1118382160 14:65226244-65226266 GGCCAATGTGGGCCACATCCAGG - Intergenic
1118877683 14:69798388-69798410 CCCAACAGTGGTTCACACCCTGG - Intergenic
1118907662 14:70034249-70034271 GGCCACAGTTGTGCCCACCAAGG + Intergenic
1119161300 14:72454472-72454494 TGCCACAGTGTTAAACACCCAGG + Intronic
1121314271 14:92951874-92951896 GGCCACAGCAGCCCACACCTAGG + Intronic
1122034614 14:98938261-98938283 GGCCACACTGGACCACACTCAGG + Intergenic
1122538926 14:102485849-102485871 GGACCCAGTGGCACACACCCTGG - Intronic
1122800937 14:104229197-104229219 GGCCACTGTGGTCCTTATCCTGG + Intergenic
1123054323 14:105562011-105562033 GTCCCCAGTGGTCCCCACCGTGG + Intergenic
1123078907 14:105682430-105682452 GTCCCCAGTGGTCCCCACCGTGG + Intergenic
1123766998 15:23490974-23490996 GGACACAGTGGTCCAGGCTCTGG + Intergenic
1124620003 15:31268290-31268312 GGCCTCACTGGGACACACCCTGG + Intergenic
1128291925 15:66484663-66484685 GGCCACAGTCTTGCACACGCAGG - Intronic
1128314826 15:66653872-66653894 GGCCTCAGTGGTCCACGTCAGGG - Intronic
1130642022 15:85685757-85685779 GGGCACGGTGGATCACACCCAGG - Intronic
1132808496 16:1786765-1786787 GGCCACACAGGTCCACATCCAGG - Exonic
1135601563 16:23788182-23788204 AGCCAGCATGGTCCACACCCTGG + Intergenic
1137576767 16:49605098-49605120 GGACCCAGTGGCCCAGACCCAGG - Intronic
1139373093 16:66480470-66480492 GCCCACCCTGGTCCACAGCCAGG + Intronic
1141508500 16:84496728-84496750 GGCCAAAGTGAGCTACACCCAGG - Intronic
1142379670 16:89724138-89724160 CGCCACACTGGCCCACACCAGGG - Intronic
1142571571 17:878302-878324 AGCCACACTGGTCGACCCCCAGG - Intronic
1142668018 17:1473491-1473513 GGGCACAGTGAGCCACACCCTGG + Intronic
1144680018 17:17187040-17187062 GGCCAGTGGGGTCCACCCCCAGG - Exonic
1147327046 17:39674634-39674656 GTCCACAGTTTTCCACACCAGGG - Exonic
1150307665 17:64100160-64100182 GGCCACAGTTCTCCAGGCCCAGG - Intronic
1151223468 17:72631285-72631307 GGCCACCGTGGAGCACAACCAGG + Intergenic
1152118437 17:78403346-78403368 GTCCACAGTAGCCCACACTCAGG - Intronic
1152127574 17:78456512-78456534 GGCCACCGTGGTCCTCACCCGGG - Intronic
1152132539 17:78485736-78485758 GGCCTCTTTGGTCCACACCACGG - Exonic
1152846181 17:82601110-82601132 GGCCACCGTGGGCCAGTCCCTGG + Intronic
1153479355 18:5531445-5531467 GGGCACAGTGGTTCACACCTGGG + Intronic
1155584501 18:27349402-27349424 AGCCAGCTTGGTCCACACCCTGG - Intergenic
1157733667 18:50027327-50027349 AGCCACAGAAGCCCACACCCAGG + Intronic
1157802622 18:50633323-50633345 GGGCACAGTGGCTCACTCCCAGG - Intronic
1158102257 18:53842567-53842589 TGCCACAGTGGTACACTTCCTGG + Intergenic
1159723154 18:71919196-71919218 GCCCACTCTGCTCCACACCCAGG + Intergenic
1159761265 18:72429849-72429871 GGTCACTGTCCTCCACACCCCGG - Intergenic
1160256390 18:77251321-77251343 GGCCCCGGTGGTCCCCACTCTGG + Intronic
1161071221 19:2262278-2262300 GGGCACAGTGGCTCACACCTGGG + Intronic
1162019914 19:7863684-7863706 GGCCTCAGTTGTCCAGACCCTGG - Exonic
1162316036 19:9938555-9938577 AGCCAGCTTGGTCCACACCCTGG + Intergenic
1163687032 19:18717548-18717570 GGCCCCAGTGCCCCACACACAGG - Intronic
1164830613 19:31317324-31317346 GGCTGCAGTGGGTCACACCCTGG - Intronic
1164884533 19:31767280-31767302 GGCCATAGTGGTCCAAAACAAGG + Intergenic
1166043261 19:40215454-40215476 GGGCACAGGGCTCCACCCCCTGG - Exonic
1166314573 19:41981873-41981895 GGCCCCCATGGTCCTCACCCGGG + Intronic
1167716274 19:51144520-51144542 GGACACAGAGGTCCCCATCCAGG - Exonic
1202705833 1_KI270713v1_random:23154-23176 AGCCAGCTTGGTCCACACCCTGG - Intergenic
925387948 2:3475730-3475752 GAACACTGTGGTCAACACCCAGG - Intronic
925526979 2:4813918-4813940 GGCCACTGTCCTCCAGACCCTGG - Intergenic
927807937 2:26164757-26164779 GGGCACAGTGGTCACCTCCCTGG + Intergenic
929170679 2:38929930-38929952 GGCCACTGTGCTCCACAGCTTGG + Intronic
931843128 2:66175369-66175391 GGCCAAAGGGGTCCAAACTCAGG + Intergenic
931917967 2:66979752-66979774 GACCAAAGTGATCCAGACCCAGG - Intergenic
932080149 2:68706880-68706902 GGCCACTGTGGTCCTCCTCCAGG + Intronic
932818233 2:74878638-74878660 GGCCACAGTGGGTCAGACACAGG + Intronic
937086807 2:119177333-119177355 GGGCACAGAGGTGCAGACCCTGG - Intergenic
937156696 2:119724910-119724932 GGCCACTGTGGGCCCCACCAGGG - Intergenic
937609181 2:123840018-123840040 GGCCACTCTGCTCCACACCTAGG + Intergenic
937904444 2:127046041-127046063 GGCCACGGAGGCCCAGACCCTGG - Intergenic
938013367 2:127847038-127847060 TGCCAAAGAGGTCCACAACCAGG - Exonic
938078744 2:128357800-128357822 GGACACAGGGGCCCACACCTTGG - Intergenic
945174107 2:207023995-207024017 GGCCCCAGGGGGCCACACTCAGG - Intergenic
945256602 2:207808347-207808369 AGCCAGTATGGTCCACACCCTGG + Intergenic
945336584 2:208599715-208599737 GGGCACAGTTGTCCAGACCCTGG - Intronic
945482968 2:210364091-210364113 GCCCTCATTGTTCCACACCCAGG - Intergenic
948252055 2:236537161-236537183 TGCCACAGTGCTACACAGCCAGG - Intergenic
1169643043 20:7776711-7776733 GGCCACCGTCCTCCAGACCCTGG + Intergenic
1171237195 20:23536576-23536598 AGCCAGCTTGGTCCACACCCTGG + Intergenic
1172151121 20:32791266-32791288 AGCCTCAGGGGTCCACACCAGGG + Intronic
1174044960 20:47726963-47726985 GGCCACACTGCTCCCCACCCAGG + Intronic
1174197134 20:48781486-48781508 GGCCACAATGGTGCAGCCCCTGG + Intronic
1174198949 20:48793844-48793866 ACTCACAGTGGTCCACTCCCAGG + Intronic
1174373691 20:50111870-50111892 GGCCACAGTGTTCCCCACTGTGG - Intronic
1174745209 20:53055314-53055336 GTCCAAAGTAGTCCACATCCAGG + Intronic
1175728067 20:61332868-61332890 GGTCACAGTGCTCATCACCCTGG + Intronic
1175890265 20:62312859-62312881 TGCCACCCTGGTCCCCACCCTGG + Intronic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176236583 20:64056401-64056423 GACCCCAGTGGACCCCACCCAGG - Intronic
1176378949 21:6102133-6102155 GGCCACAGCTGTCCTCACCCAGG - Intergenic
1178341201 21:31786740-31786762 GGCCACAGATTTGCACACCCTGG - Intergenic
1179235276 21:39540203-39540225 GGCCACCGTCCTCCAGACCCTGG - Intergenic
1179744525 21:43436104-43436126 GGCCACAGCTGTCCTCACCCAGG + Intergenic
1181928341 22:26378385-26378407 GGCCAAAGTGGCACACAGCCAGG + Intronic
1183592256 22:38786656-38786678 GCCCACAGTGGTGCAAAGCCAGG + Intronic
1183734696 22:39637263-39637285 AGCCCCATTGGTCCCCACCCTGG - Intronic
1183760425 22:39811461-39811483 AGCCCTAGTGGTCCACTCCCAGG - Intronic
1184401790 22:44278774-44278796 GGCCACAGTCAGCCACATCCAGG + Intronic
1184550927 22:45203765-45203787 GCCCACCGTGGTCCATACCATGG - Intronic
1184648463 22:45908666-45908688 GGCCACATTTGCCCAAACCCAGG - Intergenic
1184830163 22:46980456-46980478 GGGCACAGTGGCTCACACCTGGG - Intronic
951890690 3:27565326-27565348 GGACACAGGAGTCCACTCCCTGG + Intergenic
952831716 3:37570605-37570627 GTTCCCAGTGGTCCTCACCCAGG - Intronic
953593252 3:44281077-44281099 ACCCCCAGTGGTCCACACTCCGG - Intronic
954997124 3:54891917-54891939 GGCTGCAGAGCTCCACACCCAGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961326490 3:126112299-126112321 TGCCACAGGGGCCCACAGCCTGG + Intronic
963202780 3:142601652-142601674 GGGCACGTTGGTCCACACCTGGG - Intronic
965989619 3:174800642-174800664 GGCCACTGTCTTCCAGACCCTGG + Intronic
968032023 3:195508307-195508329 GGCCACAGTGGTTCAGTCCAAGG + Intergenic
968423813 4:507479-507501 GGCCAATGTGGTCCAGCCCCAGG - Exonic
971394910 4:26218682-26218704 CGCCACTGTGGTCCCCAGCCTGG + Intronic
971421414 4:26477069-26477091 AGCCAGCTTGGTCCACACCCCGG - Intergenic
975628308 4:76372302-76372324 GGCCATGGTGGTGCACACCTGGG + Intronic
976420995 4:84843680-84843702 GGGCACAGTAGCTCACACCCAGG - Intronic
981466239 4:145075835-145075857 GGCTACAGTGGAGCACAGCCAGG + Intronic
982560850 4:156926811-156926833 GGCCACTGTCCTCCAGACCCTGG - Intronic
982843296 4:160219773-160219795 GGCCACTGTCCTCCAAACCCCGG - Intergenic
985965837 5:3338343-3338365 GGCCACGGTGGTCTCCACCTGGG - Intergenic
988800312 5:34690465-34690487 GGCCACTGTGAGCAACACCCAGG + Intronic
989384880 5:40845299-40845321 GGCCAAAGGGGTGCACACTCAGG - Intronic
990517926 5:56547873-56547895 GGCCAGAGTGGTCTAAACCAAGG - Intronic
992323300 5:75635647-75635669 AGATACAGTGGTCCACACTCTGG + Intronic
993944043 5:94097075-94097097 GGCTACAGTGGAGCACAGCCAGG + Intronic
996502138 5:124229506-124229528 AGCCAGCCTGGTCCACACCCTGG - Intergenic
998132935 5:139660285-139660307 GGCCACAGTCGGGCACAACCCGG - Intronic
998253392 5:140567396-140567418 GGCCCCAGGGGCCCCCACCCTGG + Exonic
1000920380 5:167130629-167130651 GGCCATGTGGGTCCACACCCAGG + Intergenic
1002105479 5:176877619-176877641 CCCCACAGTGGTCCATAGCCAGG - Exonic
1003811670 6:9789349-9789371 GGCGCCAGGGGGCCACACCCAGG + Intronic
1004267924 6:14165487-14165509 GGCCAGAGTGGCCCAAACACTGG + Intergenic
1007091823 6:39189586-39189608 GGACACAGTGGGCCAGCCCCAGG + Exonic
1010601138 6:77827671-77827693 GGCTACTGTGGTCCAAACCATGG - Intronic
1010938976 6:81893451-81893473 GGTAACAGTGCTCCATACCCTGG - Intergenic
1011436118 6:87339052-87339074 GGCCACAGTGGCTCACACCAAGG + Intronic
1018041039 6:159922361-159922383 GGCCACTGTCCTCCAGACCCTGG + Intergenic
1018370378 6:163162748-163162770 GGACCCAGTGGGCCTCACCCTGG - Intronic
1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG + Intergenic
1019404600 7:876966-876988 GGCCACACAGGGCCAGACCCCGG - Intronic
1020203058 7:6095179-6095201 GCCCACAGTGGTCAATTCCCTGG - Intergenic
1021579629 7:22139237-22139259 GACCACAGTGAGCCACACGCAGG + Intronic
1022044561 7:26612634-26612656 GACCACACTGGCCCTCACCCAGG + Intergenic
1022178050 7:27891195-27891217 GGCCACAGTTTTCCAACCCCTGG - Intronic
1022922098 7:35025974-35025996 AGCCACAGTGGTCCAAACTCTGG + Intronic
1023040738 7:36170961-36170983 GGCCACTGTACTCCACAGCCTGG - Intronic
1023678158 7:42652530-42652552 GGCCACAGTTTGCCACCCCCTGG - Intergenic
1023731477 7:43196017-43196039 AGCCAGCTTGGTCCACACCCTGG + Intronic
1024115429 7:46188252-46188274 GGACACAGTGGTTCACACTGAGG + Intergenic
1024981145 7:55158739-55158761 GGCCTCAGTGAGTCACACCCTGG - Intronic
1026852827 7:73735648-73735670 GGCCATACTCGTCCACCCCCAGG + Intergenic
1027180339 7:75935016-75935038 GGCCACTGTCCTCCAGACCCCGG + Intronic
1027223048 7:76226218-76226240 GGACACAGTGGGCCACAAACTGG - Intronic
1027954074 7:84857482-84857504 GTCCTCTGTGGTCCCCACCCAGG + Intergenic
1028745268 7:94320284-94320306 GGCCACTGTCCTCCAGACCCTGG - Intergenic
1033607257 7:142936442-142936464 GGACACCATGGTCCTCACCCAGG - Intergenic
1035952970 8:4044657-4044679 GGCCAGGGTGGTACACGCCCAGG - Intronic
1036544059 8:9749421-9749443 AGCCACAGTGAACCACTCCCTGG - Intronic
1037744151 8:21629949-21629971 GGCCACAGTCAGCCACCCCCAGG + Intergenic
1038424207 8:27454069-27454091 GGCCACAGTGGTGCCTGCCCAGG + Intronic
1039180858 8:34864400-34864422 AGCCAGATTGGTCCACACCCTGG + Intergenic
1042877597 8:73453850-73453872 GGCTACACTGACCCACACCCGGG - Intronic
1042976812 8:74478680-74478702 GGCTACAGTGGAGCACAGCCAGG - Intronic
1043518588 8:81019804-81019826 GGCCACTGTCCTCCAGACCCTGG + Intronic
1043891917 8:85658335-85658357 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043894187 8:85724362-85724384 GGGCTCAGTAGTCCACATCCTGG - Intergenic
1043894543 8:85727447-85727469 GGGCTCAGTAGTCCACATCCTGG - Intergenic
1043894899 8:85730532-85730554 GGGCTCAGTAGTCCACATCCTGG - Intergenic
1043895255 8:85733617-85733639 GGGCTCAGTAGTCCACATCCTGG - Intergenic
1043897421 8:85748191-85748213 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043897777 8:85751279-85751301 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043898133 8:85754364-85754386 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043899747 8:85766559-85766581 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043901354 8:85778752-85778774 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043901709 8:85781837-85781859 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043903319 8:85794027-85794049 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043904930 8:85806220-85806242 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1043906541 8:85818411-85818433 GGGCTCAGTAGTCCACATCCTGG + Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1046949815 8:120009088-120009110 GGCCACTGGGGTCTACAGCCTGG - Exonic
1047946679 8:129887526-129887548 GGCCACCATGCTCCAGACCCCGG + Intronic
1049589252 8:143448703-143448725 GGCCACTGTCCTCCAGACCCTGG - Intronic
1049757690 8:144318077-144318099 GCCCACAGAGGTCCTCACCGCGG + Exonic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1056491393 9:87111052-87111074 GGCCACATTTTGCCACACCCTGG + Intergenic
1057325676 9:94061390-94061412 GGCCACTGTCTTCCAGACCCTGG - Intronic
1057667882 9:97060918-97060940 TGCCACAGAGGAGCACACCCTGG + Intergenic
1061918437 9:133769293-133769315 GGCCACAGTTGTCCGCAGTCTGG - Intronic
1062502803 9:136858512-136858534 GCCCCCTGTGGACCACACCCTGG + Exonic
1191987704 X:67000510-67000532 GGCCACTGTCCTCCAGACCCTGG - Intergenic
1194339780 X:92693985-92694007 GGCCACTGTTCTCCAGACCCCGG - Intergenic
1198612551 X:138418126-138418148 AGCCACCGTCCTCCACACCCTGG + Intergenic
1199437466 X:147828739-147828761 GGGAACAGTGGTCCACACACAGG + Intergenic
1199912996 X:152307946-152307968 GGCTACAGTGGAGCACAGCCAGG + Intronic
1200246844 X:154531007-154531029 GTCCACAGTGATGCACAGCCAGG - Intergenic
1200296496 X:154925400-154925422 GGCCACCGTCCTCCAGACCCCGG + Intronic
1200701354 Y:6405234-6405256 TGACACAGTAGTCCACACCATGG - Intergenic
1200736587 Y:6805246-6805268 GGCCACAGTTGGCCAATCCCTGG + Intergenic
1201032757 Y:9759464-9759486 TGACACAGTAGTCCACACCATGG + Intergenic