ID: 1053071208

View in Genome Browser
Species Human (GRCh38)
Location 9:35103098-35103120
Sequence TCCGGAGGTCGCTGCGGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053071208_1053071212 -6 Left 1053071208 9:35103098-35103120 CCACCGCCGCAGCGACCTCCGGA 0: 1
1: 0
2: 0
3: 14
4: 209
Right 1053071212 9:35103115-35103137 TCCGGAACCAACGAGACGAGCGG 0: 1
1: 0
2: 0
3: 0
4: 5
1053071208_1053071214 -1 Left 1053071208 9:35103098-35103120 CCACCGCCGCAGCGACCTCCGGA 0: 1
1: 0
2: 0
3: 14
4: 209
Right 1053071214 9:35103120-35103142 AACCAACGAGACGAGCGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053071208 Original CRISPR TCCGGAGGTCGCTGCGGCGG TGG (reversed) Exonic
900105477 1:979134-979156 CCCAGAGGTCGAGGCGGCGGGGG - Exonic
901086096 1:6613395-6613417 GGCGGGAGTCGCTGCGGCGGTGG - Intronic
903048005 1:20578875-20578897 TTCTGAGGTGGCTGCAGCGGAGG - Intergenic
904782934 1:32964397-32964419 GGCGGAGGCCGCGGCGGCGGCGG - Exonic
905067079 1:35192811-35192833 TGCGGCGGTGGCTGCTGCGGTGG + Exonic
905449289 1:38046650-38046672 CCCGGACGCCGCGGCGGCGGCGG - Exonic
907341547 1:53739191-53739213 CCCGCAGGACGCGGCGGCGGCGG - Intergenic
908829251 1:68163356-68163378 TCTGGAGGCCGCGGTGGCGGTGG + Intronic
913615718 1:120558169-120558191 TCCCGAGGCGGCGGCGGCGGCGG + Intergenic
913632520 1:120723954-120723976 TCCGGCGGCGGCTGAGGCGGCGG + Intergenic
914574558 1:148952733-148952755 TCCCGAGGCGGCGGCGGCGGCGG - Intronic
914889754 1:151612250-151612272 AACGGAGGTGGCGGCGGCGGCGG + Exonic
915070335 1:153261127-153261149 TCTGGCGGCGGCTGCGGCGGGGG + Exonic
916548455 1:165828089-165828111 GCCTGGGGGCGCTGCGGCGGGGG + Intronic
917329678 1:173868482-173868504 CCAGGAGCGCGCTGCGGCGGAGG - Intronic
920302484 1:204997445-204997467 TCTGGAGGCCGCTGGGGAGGCGG - Intronic
920705007 1:208244296-208244318 TCCCGCGGTGGCGGCGGCGGCGG + Exonic
920827091 1:209432270-209432292 TACGGTGGTGGCGGCGGCGGTGG - Intergenic
921390568 1:214609184-214609206 TTCGGGGGGAGCTGCGGCGGTGG - Intronic
922315077 1:224434676-224434698 CCCGGCAGTGGCTGCGGCGGCGG + Intronic
922416515 1:225427742-225427764 TCGGGTGGTCGGGGCGGCGGCGG - Intronic
922587878 1:226749336-226749358 TCAGGAGCTCGCTACTGCGGAGG + Intergenic
922958588 1:229625910-229625932 CCCGGAGGCGGCGGCGGCGGGGG - Exonic
924172417 1:241356679-241356701 TCCGGCGGCCGCCGCGGCGCGGG - Intronic
924436696 1:244048944-244048966 GGCGGAGGACGCGGCGGCGGCGG + Intronic
1062874032 10:931320-931342 CCCGGAGGACGCGGCCGCGGCGG - Intronic
1064230944 10:13528945-13528967 GCCTGCGGTCGCGGCGGCGGCGG + Intronic
1069019185 10:63466134-63466156 TCCAGAGGCGGCGGCGGCGGCGG + Intergenic
1069486625 10:68827808-68827830 TCCAGGGCTGGCTGCGGCGGGGG + Exonic
1069486712 10:68828144-68828166 TCCAGGGCTGGCTGCGGCGGGGG + Intronic
1076309644 10:129495978-129496000 CCTGGAGGTCCCTGCGGCTGGGG + Intronic
1077674966 11:4187447-4187469 TGCGGCGGCCGCGGCGGCGGCGG + Intergenic
1083033492 11:59615499-59615521 GACGGTGGTCGCGGCGGCGGCGG - Exonic
1087672972 11:101128410-101128432 TCCGCAGGCCGCTGCGGTGGAGG - Exonic
1092518436 12:9240406-9240428 GCCGGAGTCCGCGGCGGCGGAGG + Intergenic
1092796047 12:12111066-12111088 GCCGGAGTCCGCGGCGGCGGAGG - Intronic
1094653432 12:32399393-32399415 GCCGGAGGAGGCGGCGGCGGCGG + Intergenic
1095752804 12:45729689-45729711 GCCGGCGGTGGCGGCGGCGGCGG - Exonic
1096593115 12:52675485-52675507 TCTGGAGGTGGCGGCGGCGGCGG - Exonic
1097057477 12:56258469-56258491 GGCGGAGGGCGCTGCGGCCGGGG - Intergenic
1103954252 12:124567589-124567611 CCCGGCGGCCGCGGCGGCGGTGG + Intronic
1106233951 13:27845663-27845685 TTCAGAGGTCACTGAGGCGGTGG - Intergenic
1108227468 13:48303979-48304001 TCAGGAGGGGGCGGCGGCGGCGG - Exonic
1108292705 13:48976572-48976594 TCCGGAGGGCTCGGGGGCGGGGG + Intronic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1118737271 14:68710983-68711005 TCCAGTGGTGGCTGCGGCGAAGG - Intronic
1121742506 14:96264116-96264138 GCCGGAGGCAGCAGCGGCGGAGG + Exonic
1123004418 14:105314581-105314603 TCCGGCGCGCGCTGCGCCGGCGG + Exonic
1125501081 15:40240691-40240713 TCCGGAGCACGCAGCGGCAGTGG - Intronic
1127433322 15:58933294-58933316 TCCGCAGGTCCCAGCGGCTGCGG + Intronic
1127475939 15:59333346-59333368 TCCGGGGGTTGCTGTGGTGGAGG - Intronic
1129016719 15:72474865-72474887 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
1129116738 15:73368860-73368882 GCCGGAGGGCGCTTCGGGGGAGG - Exonic
1129383000 15:75179325-75179347 TCTGGAGGAAGCTGCGGGGGAGG + Intergenic
1129456321 15:75677712-75677734 TCCAGAGGTGGCTGGGGCGCTGG + Exonic
1130076521 15:80695057-80695079 CCCGGAAGTGGCGGCGGCGGCGG + Intronic
1130432140 15:83859423-83859445 ACCGGAGGTCTCTGTGCCGGTGG + Intronic
1132584679 16:700957-700979 TCCGGAGGAGGCGGCGGGGGCGG + Intronic
1133034804 16:3028658-3028680 CCCAGAGGGCGCTGGGGCGGTGG + Intronic
1133056867 16:3149768-3149790 TCCGCAGCTCGCTCCGGCGCCGG + Exonic
1133802025 16:9091995-9092017 TGAGGAGGACGCGGCGGCGGTGG + Exonic
1134402330 16:13920977-13920999 ATCGGAGGTCGCTGCAGGGGAGG + Intronic
1135435168 16:22421832-22421854 TCCGGAGGTCGAGGCTGCAGTGG + Intronic
1135735819 16:24931137-24931159 TGCGTAGGGGGCTGCGGCGGTGG + Exonic
1136220197 16:28823503-28823525 TCCTGGTGTTGCTGCGGCGGCGG - Exonic
1136226503 16:28863898-28863920 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1136458471 16:30395536-30395558 TCCGGAGGGCGCCGGGGTGGCGG + Exonic
1136628585 16:31476617-31476639 TCCGGAGGTCGGAGGGGCTGGGG - Intronic
1140209179 16:72957802-72957824 GGCGGCGGTGGCTGCGGCGGCGG - Exonic
1141079156 16:81035809-81035831 GCCGGAAGTGGCTGCGGCGGGGG + Intergenic
1141116777 16:81315571-81315593 TCGGGCGCTCGCCGCGGCGGTGG - Intronic
1147429561 17:40363076-40363098 GGCGGAGGTGGCGGCGGCGGCGG + Exonic
1149626409 17:58083557-58083579 GCCGGAGACCGCGGCGGCGGCGG + Exonic
1151674119 17:75589184-75589206 TCCTGCGCTGGCTGCGGCGGCGG + Intergenic
1151871818 17:76841739-76841761 TCCGGAGGACGCTGCTGGAGGGG - Intergenic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1155055287 18:22177006-22177028 TCCAGACGCCGCTGTGGCGGCGG + Exonic
1155654333 18:28177049-28177071 GCCGGAGGAGGCGGCGGCGGCGG + Exonic
1158725710 18:59969707-59969729 TCCGGTGGACGAGGCGGCGGCGG - Intergenic
1161408344 19:4102721-4102743 TCCTGAGGTCGCCACGGCAGAGG + Intronic
1161851406 19:6739726-6739748 TGCGGTGGTGGCTGCGGCGGCGG + Exonic
1162019926 19:7863726-7863748 TCAGGAGGCCGCAGCCGCGGGGG + Intronic
1162100214 19:8334650-8334672 TGCGGAGGAGGCAGCGGCGGGGG - Exonic
1162128505 19:8511817-8511839 TCCGGGGGGCGCTCCGGCGCGGG + Exonic
1162741341 19:12775485-12775507 CCCGGAGGCTGCTGCGGCGCCGG - Exonic
1165511480 19:36268951-36268973 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165512028 19:36271474-36271496 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165512576 19:36273973-36273995 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165513127 19:36276516-36276538 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165513682 19:36279069-36279091 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165514231 19:36281603-36281625 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165514785 19:36284142-36284164 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165515337 19:36286673-36286695 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165515887 19:36289211-36289233 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165516438 19:36291746-36291768 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165516990 19:36294274-36294296 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165517543 19:36296797-36296819 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165518095 19:36299332-36299354 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165518646 19:36301867-36301889 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165519194 19:36304397-36304419 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165519743 19:36306912-36306934 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165520294 19:36309442-36309464 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
1165624319 19:37271680-37271702 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165625403 19:37276745-37276767 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165625936 19:37279270-37279292 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165626480 19:37281797-37281819 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165627019 19:37284322-37284344 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165627562 19:37286846-37286868 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165628639 19:37291896-37291918 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165629722 19:37296947-37296969 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165630264 19:37299474-37299496 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1165630803 19:37302012-37302034 GCTGGAGGTTGCGGCGGCGGCGG + Intergenic
1168251973 19:55146690-55146712 TCCAGAGGAGGCTGCGGAGGAGG - Exonic
1168339124 19:55613808-55613830 TGCGGCGGGGGCTGCGGCGGGGG - Exonic
926719134 2:15945875-15945897 ACCGAAGGTCGTTGCGGCGCTGG - Exonic
928606358 2:32947622-32947644 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935592884 2:104857038-104857060 TGCGGAGGCGGCGGCGGCGGCGG - Exonic
943033794 2:182716167-182716189 CCCAGCGGGCGCTGCGGCGGTGG - Intronic
944412442 2:199457721-199457743 CCCGGAGGCGGCGGCGGCGGCGG + Exonic
944632773 2:201643457-201643479 CCCGGAGGCCGCTGCGTCGCGGG - Exonic
945648912 2:212536978-212537000 TCCGGAGGTGGCTGGAGCGCGGG + Intronic
947197962 2:227587439-227587461 TGCGGTGGTGGCTGCGGTGGTGG - Intergenic
947199124 2:227599019-227599041 TGCGGTGGTGGCTGCGGTGGTGG + Intergenic
947200286 2:227608856-227608878 TGCGGTGGTGGCTGCGGTGGTGG + Intergenic
947201010 2:227614752-227614774 TGCGGTGGTGGCTGCGGTGGTGG - Intronic
947201013 2:227614764-227614786 TGCGGTGGTGGCTGCGGTGGTGG - Intronic
947201381 2:227617579-227617601 TGCGGTGGTGGCTGCGGTGGTGG + Intronic
947213431 2:227728389-227728411 TGCGGTGGTGGCTGCGGTGGTGG + Intergenic
947213434 2:227728401-227728423 TGCGGTGGTGGCTGCGGTGGTGG + Intergenic
947215470 2:227745963-227745985 TGCGGTGGTGGCTGCGGCGGTGG + Intergenic
947641165 2:231708610-231708632 GCCGGAGTCCGCGGCGGCGGAGG - Exonic
1170756917 20:19212878-19212900 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1172428615 20:34872848-34872870 GCCGGAAGTGGCTGCGGCGGGGG + Exonic
1178961911 21:37073288-37073310 GCCGGAGGTGGCGGCGGCGGCGG + Intronic
1179605619 21:42513744-42513766 GCCGGGGGTCGCGGCGGCCGGGG + Intronic
1182237008 22:28883826-28883848 ACCGGAGGCCGCGGGGGCGGCGG - Exonic
1183412202 22:37661446-37661468 TTCGGAGGTCCCTGGGGCAGGGG - Intronic
1183517032 22:38272724-38272746 TACGGAGGCCGGTGCGGCCGCGG - Intronic
1185078257 22:48694814-48694836 GGCGGAGGTCGGAGCGGCGGCGG - Intronic
949969915 3:9396446-9396468 TCCTGAGGGAGCTGCGGTGGAGG - Intergenic
953705208 3:45225817-45225839 CCCGGAGGAGGCGGCGGCGGCGG - Exonic
953886574 3:46717622-46717644 TCCGCAGGTTGCTGGGGCGCAGG - Exonic
961013383 3:123449764-123449786 TGCGGAGGGCTCTCCGGCGGCGG - Intergenic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
963236869 3:142964105-142964127 TCCGGAGGTCGCCGGGGAGGGGG + Intergenic
964219124 3:154324289-154324311 TCCGGAGGAGGCGGCGGCGGCGG - Exonic
966919242 3:184601684-184601706 TCGGGAGGTGGCTCCGGCTGCGG - Intronic
967916718 3:194583894-194583916 TGCGGCGGCGGCTGCGGCGGCGG + Intergenic
968114979 3:196082246-196082268 TGCGGAGGGCGCTGCGGGCGAGG + Intergenic
971257939 4:25030915-25030937 TGCGGCGGGCGCAGCGGCGGCGG - Intergenic
975973772 4:80072762-80072784 TCCGGCGGCAGCTGCGGCGGTGG - Intronic
977257544 4:94757910-94757932 TCCCGCGGTGGCGGCGGCGGCGG + Intergenic
978072535 4:104491318-104491340 GCCGGCGGTGGCGGCGGCGGCGG - Exonic
978184094 4:105836615-105836637 TCCAGAGGGGGCTGAGGCGGGGG + Intronic
978384642 4:108167733-108167755 TCCGGAGGAGGTGGCGGCGGCGG - Exonic
979086538 4:116417679-116417701 TGCGGTGGTCGCGGGGGCGGTGG + Intergenic
980354542 4:131724912-131724934 CCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980355622 4:131729905-131729927 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980357236 4:131737372-131737394 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980357779 4:131739867-131739889 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980358849 4:131744847-131744869 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980359389 4:131747320-131747342 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980359932 4:131749788-131749810 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980360471 4:131752283-131752305 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980361013 4:131754755-131754777 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980361554 4:131757238-131757260 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980362096 4:131759710-131759732 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
980362638 4:131762193-131762215 GCTGGAGGTTGCGGCGGCGGCGG - Intergenic
983940285 4:173529558-173529580 ACCGGAGGCGGCGGCGGCGGCGG - Exonic
985541907 5:491345-491367 TCCGGCTGTGGCTGCAGCGGTGG + Intronic
986297119 5:6448809-6448831 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
986451441 5:7869342-7869364 TCCGGGGGTCGCCGCGGGCGCGG + Intronic
987050462 5:14143751-14143773 GCCGGAGGACGCGGCGGGGGCGG - Exonic
990557453 5:56951293-56951315 GCTGGAGCTCGCTGGGGCGGGGG - Intronic
992269936 5:75053556-75053578 TGCGGAGGCCGCCCCGGCGGGGG + Intergenic
996055071 5:118973699-118973721 GCCGGAGTCCGCGGCGGCGGAGG - Intronic
997259198 5:132452992-132453014 CCTGGAGGTGGCAGCGGCGGTGG + Intronic
997899830 5:137754315-137754337 AGCGGAGGTGGCGGCGGCGGCGG - Exonic
997975378 5:138438968-138438990 CCGGGAGGCCGCCGCGGCGGCGG - Intergenic
999759695 5:154690818-154690840 TCCTGAGGACTGTGCGGCGGTGG - Intergenic
1001506376 5:172283722-172283744 GCCGGAGGAGGCTGCAGCGGCGG - Exonic
1002219945 5:177672212-177672234 TTCTGAGGTGGCGGCGGCGGGGG + Intergenic
1004193976 6:13487714-13487736 CCCGGAGCTGGCGGCGGCGGGGG - Intergenic
1007665296 6:43509941-43509963 TGCGGCGGAGGCTGCGGCGGGGG + Exonic
1010386339 6:75284756-75284778 AGCGGAGGTGGCTGTGGCGGTGG - Exonic
1014246670 6:119078008-119078030 TCCGGCTGTTGCTTCGGCGGAGG + Intronic
1015149268 6:130019983-130020005 GGCGGCGGTCGCGGCGGCGGCGG + Intronic
1018400493 6:163415142-163415164 TCCGGCGGCGGCGGCGGCGGCGG + Exonic
1019343661 7:519755-519777 CCCGGCGGCGGCTGCGGCGGAGG - Intronic
1019529042 7:1494562-1494584 TCCGGGGGAGGCTGCGGCTGGGG + Intronic
1019731508 7:2631928-2631950 TGCGGAGGGGGCGGCGGCGGCGG + Intergenic
1021451255 7:20785341-20785363 TCCGGGGGCAGCGGCGGCGGCGG - Exonic
1021992713 7:26152887-26152909 TCCGGTGGACGAGGCGGCGGCGG - Exonic
1022090048 7:27102141-27102163 TGCGGCGGTGGCGGCGGCGGCGG + Exonic
1022106211 7:27199667-27199689 TCCCGAGGACGACGCGGCGGCGG + Exonic
1022739725 7:33109416-33109438 TCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1027218891 7:76201817-76201839 TGCGGAGGGCGCTGCGGGCGCGG + Intergenic
1027374540 7:77537198-77537220 TCCTGAGGCGGCGGCGGCGGCGG + Intergenic
1029276554 7:99408555-99408577 TCCGGCGGCTGCGGCGGCGGCGG + Exonic
1035169609 7:157010208-157010230 ACCGGAGGTGGCGGCGGCGGCGG - Exonic
1035663170 8:1362411-1362433 TCCCGAGGGCGCTGTGACGGCGG - Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1041839187 8:62249006-62249028 TCAGGAGGCAGCAGCGGCGGAGG + Exonic
1042155692 8:65841974-65841996 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1047606332 8:126478293-126478315 TCCAGAGGTCCCTGCCGGGGTGG + Intergenic
1051936379 9:22447253-22447275 TCCCGAGGTGGCGGCAGCGGCGG - Exonic
1053071208 9:35103098-35103120 TCCGGAGGTCGCTGCGGCGGTGG - Exonic
1054906649 9:70419187-70419209 TCCTCAGGCTGCTGCGGCGGCGG - Intergenic
1055939981 9:81640027-81640049 TGTGGAGGTCACTGCGGGGGAGG + Intronic
1059483710 9:114611525-114611547 TCCCGGGGTGGCGGCGGCGGCGG + Exonic
1060634444 9:125189276-125189298 TCCCGAGGGCACTGCCGCGGGGG + Intronic
1060770220 9:126326969-126326991 GGCGGCGGTGGCTGCGGCGGCGG - Exonic
1061541079 9:131278037-131278059 TCCGCAGGCGGCGGCGGCGGCGG + Intergenic
1061961675 9:133991985-133992007 CGCGGAGGTCGCAGCGGCGGCGG - Intronic
1061975801 9:134067638-134067660 TCGGGGCGTCGCTGCGGCCGGGG - Intronic
1061975832 9:134067726-134067748 GCCCGGGGTCGCGGCGGCGGTGG - Intronic
1062314797 9:135961343-135961365 CCCGGCGGCTGCTGCGGCGGCGG - Exonic
1186426096 X:9465210-9465232 GCCTGAGGGCGCTGCGGCGGCGG - Exonic
1189137120 X:38561514-38561536 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1190220399 X:48509037-48509059 CCCGGAGGAGGCAGCGGCGGCGG + Intronic
1192925023 X:75747169-75747191 GCCGGAGGTGGCGGCGGCGGCGG - Intergenic
1193654993 X:84187997-84188019 GCTGGGGGTCGCGGCGGCGGCGG - Intergenic
1194421064 X:93673402-93673424 TGCGGAGGTGGCAGCGGCGATGG + Exonic