ID: 1053071767

View in Genome Browser
Species Human (GRCh38)
Location 9:35106112-35106134
Sequence GGTGAGGAGAACTCTACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053071767_1053071771 -2 Left 1053071767 9:35106112-35106134 CCTACAGTAGAGTTCTCCTCACC 0: 1
1: 0
2: 1
3: 5
4: 92
Right 1053071771 9:35106133-35106155 CCTGGCCCTGACTCACTTCTAGG 0: 1
1: 0
2: 2
3: 37
4: 491
1053071767_1053071773 3 Left 1053071767 9:35106112-35106134 CCTACAGTAGAGTTCTCCTCACC 0: 1
1: 0
2: 1
3: 5
4: 92
Right 1053071773 9:35106138-35106160 CCCTGACTCACTTCTAGGTGAGG 0: 1
1: 0
2: 0
3: 22
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053071767 Original CRISPR GGTGAGGAGAACTCTACTGT AGG (reversed) Intronic
904030305 1:27529302-27529324 GGCCAGGAGAACTCTGCTTTGGG - Intergenic
906608726 1:47188033-47188055 GGAGGGGTGAACTCTACTCTGGG + Intronic
907511694 1:54966168-54966190 AGTAAGGAGAAGTCTGCTGTGGG + Intergenic
908894720 1:68885295-68885317 GATGAGGAGACCACTATTGTTGG + Intergenic
915773531 1:158456042-158456064 GGTGAGCAGAAATGTGCTGTTGG + Intergenic
918982856 1:191586240-191586262 GGTGAGGAGAGCAATAATGTTGG - Intergenic
921189036 1:212693652-212693674 GGGGTGGAGACCTCTTCTGTAGG - Intronic
922868545 1:228881563-228881585 GGGAAAGAGAACTCTACTCTGGG + Intergenic
923177697 1:231483563-231483585 GGTTTGGAGAACTCAATTGTTGG - Intergenic
1066267017 10:33786227-33786249 TGTGAAAAGAATTCTACTGTGGG + Intergenic
1067327918 10:45287274-45287296 GGTGAGGAGAAGTCTATTGTGGG + Intergenic
1067524201 10:47028472-47028494 GGTGTGGAGAACTCTGGTGAGGG - Intergenic
1074899503 10:117804093-117804115 GGATAAGAGAACTCGACTGTAGG - Intergenic
1078689332 11:13563213-13563235 GGTGGGAAGAACTCTGCTGGTGG - Intergenic
1079278819 11:19069949-19069971 GGTGAGGACAACTCTGTTTTTGG + Intergenic
1080306352 11:30840594-30840616 GGTGAGGAGAATACTCATGTGGG + Intronic
1081248973 11:40805627-40805649 TGGGAAGAGAACTTTACTGTAGG - Intronic
1087949995 11:104209125-104209147 GGTAGAGAGAACTCTACTTTAGG - Intergenic
1088586415 11:111363743-111363765 TCTCTGGAGAACTCTACTGTGGG - Intronic
1090434977 11:126679008-126679030 TGTAAGGAGAACTCTGCTGAGGG + Intronic
1091526265 12:1304370-1304392 TGTGAGTAAAAGTCTACTGTTGG - Intronic
1092175262 12:6400376-6400398 GGAGAGGAGAGCTCTGCTGGTGG + Intergenic
1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG + Intergenic
1100167406 12:91931648-91931670 GGTGAGGAAAACTCTCAAGTAGG + Intergenic
1100429753 12:94520596-94520618 CCTGAGGAGAATTCTCCTGTGGG - Intergenic
1104577476 12:129980903-129980925 GGTGATGAGAGCCTTACTGTAGG + Intergenic
1109179790 13:59200064-59200086 GATCAGCAGAACTCTACAGTTGG - Intergenic
1111039875 13:82733693-82733715 TGTGAGCAGAAATCTACTTTGGG + Intergenic
1119982607 14:79098911-79098933 CCTAAGGAGAACTCTACTGGAGG - Intronic
1122932088 14:104938331-104938353 GATGAGGAGAACCCTAATTTGGG + Exonic
1124685497 15:31778317-31778339 GGTGAGGAGAAATATACCATGGG + Intronic
1125274671 15:37978137-37978159 GGTTGGGACAACTGTACTGTGGG + Intergenic
1125425971 15:39549715-39549737 GGGGAAGAGAACTCTACACTGGG + Intergenic
1125987314 15:44066692-44066714 GGTGATAAGAACTTTACTTTGGG + Intronic
1128976502 15:72158036-72158058 GATATGGAGAACTGTACTGTTGG - Intergenic
1136587151 16:31194049-31194071 GGTGGGGAGAGCTGTGCTGTAGG + Exonic
1138042372 16:53686088-53686110 GGTGACAAGAACTCAACTGTTGG - Intronic
1145777948 17:27542536-27542558 GATGGGGAGATCTCTTCTGTGGG - Intronic
1148933894 17:51149323-51149345 GGGGAGGAGCACTCAACTGGGGG - Intergenic
1149270406 17:54970687-54970709 GGTGAGTGGAAATGTACTGTTGG - Intronic
1153647505 18:7208248-7208270 GGAGAGGAGAATTTTAGTGTTGG - Intergenic
1154364756 18:13697705-13697727 GGTGAATAGAACTTAACTGTTGG - Intronic
1157569935 18:48705575-48705597 GGTGAGGAGGACTTTACAGATGG + Intronic
1160261758 18:77300815-77300837 GGTGAGGGGAACAATGCTGTGGG - Intergenic
1161812101 19:6476875-6476897 GGTGAGCAGGACTCTTCTCTCGG + Exonic
1162913612 19:13863003-13863025 GCTGGGGAGAACTCTACCCTGGG + Intronic
925525061 2:4790754-4790776 AGTGAGGAAAACTCTGTTGTTGG - Intergenic
928277108 2:29912807-29912829 GGTGAGGAGAACACTAGATTAGG - Intronic
929553362 2:42908114-42908136 GGTAAGGAGAAGTCTGCTGGGGG + Intergenic
931160398 2:59683885-59683907 GGTCAGGGGAACTCTGCTGTTGG - Intergenic
936478751 2:112865647-112865669 GGTGAGGAGAATACTAATGAAGG - Intergenic
938235676 2:129704656-129704678 GGTGAGGGGAACTCTGCAGATGG - Intergenic
938957335 2:136310583-136310605 TGTGAGGGGAAATCCACTGTGGG + Intergenic
943867656 2:192948592-192948614 GCTAAGGAGAACTCTACTAGTGG - Intergenic
945885284 2:215369536-215369558 GGAGTAGAGAACTCTCCTGTTGG + Intronic
947111066 2:226720332-226720354 GGTGAGGGGATCTGGACTGTTGG - Intergenic
1170844131 20:19947898-19947920 GGTATGGAGAACTCTCCTCTTGG - Intronic
1176235570 20:64052015-64052037 GGTGAGGGGGACTCTAGTGCTGG + Intronic
1177766701 21:25466559-25466581 GATGAGGAGAGATTTACTGTGGG - Intergenic
1181014475 22:20061324-20061346 GGAGAGGAGAACTCAGCAGTAGG - Intronic
1183258420 22:36778024-36778046 GTGGAGGAGAAGTTTACTGTGGG - Intergenic
951480892 3:23161246-23161268 TGTGAGGAGAGGTCTACAGTAGG + Intergenic
961812127 3:129527981-129528003 GCTGAGGAGGACTCAAATGTGGG - Intergenic
964872981 3:161333855-161333877 TGGGAGGAGAACTCTGCTGAAGG + Intergenic
967608094 3:191471989-191472011 GGTGAAGTTAACTCTATTGTTGG + Intergenic
967642272 3:191879504-191879526 GGTGAGAAGAAATCTGCTGAAGG - Intergenic
969354911 4:6619617-6619639 GGAGAGGAGAACTCCGCGGTGGG + Intronic
978092313 4:104732679-104732701 GGTGAGGAGTACTCAAATATTGG - Intergenic
983264984 4:165499213-165499235 GGTGAGGAGAAGTGGACTTTGGG + Intergenic
987334210 5:16884542-16884564 GTTTAGGAGATCTCTAATGTAGG + Intronic
995591064 5:113699957-113699979 AGAGTGGACAACTCTACTGTGGG - Intergenic
996980032 5:129480766-129480788 GCTGAGTAGTACTCTACTGTAGG - Intronic
1005236244 6:23765294-23765316 GGTAAGGGGAACTGTACTGATGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006850285 6:37093229-37093251 GGTGAGGAGACCCCCACTGGAGG - Intergenic
1007997293 6:46321779-46321801 GGTGTGGAGAACTGAAGTGTTGG + Intronic
1008120658 6:47613000-47613022 TGTGAGGTGGAATCTACTGTTGG - Intronic
1016697454 6:147014569-147014591 GCTGAGTAGTATTCTACTGTAGG - Intergenic
1033366347 7:140674751-140674773 GGGGAGGAGAACTCACCTGTTGG - Exonic
1035815513 8:2535630-2535652 GGTGAGAAGAACATTCCTGTTGG - Intergenic
1036115001 8:5949531-5949553 AGTGAGGAGAAAAATACTGTTGG - Intergenic
1036461410 8:8956608-8956630 AGCCAGGAGAACTCTAATGTGGG + Intergenic
1042233724 8:66586554-66586576 AGAAAGGGGAACTCTACTGTTGG + Intronic
1043480394 8:80646681-80646703 GGTGAGGAGGATTCTGCTCTTGG - Intronic
1044549820 8:93499333-93499355 GATGAAGGAAACTCTACTGTAGG + Intergenic
1046878466 8:119281550-119281572 GGTGAAGTGCACTCTACTATAGG - Intergenic
1051246784 9:15119655-15119677 CGTGAGGAGACCTCTTCTGCTGG - Intergenic
1051342326 9:16122976-16122998 TGTGAGGAAAAGTCTGCTGTGGG + Intergenic
1053071767 9:35106112-35106134 GGTGAGGAGAACTCTACTGTAGG - Intronic
1056221151 9:84451749-84451771 GGTGGGGAAAGCCCTACTGTAGG - Intergenic
1186356243 X:8794205-8794227 GGAGAGGAGAACACTGTTGTTGG - Intronic
1186377985 X:9028413-9028435 GGAGAGGAGAACACTGTTGTTGG - Intronic
1186619663 X:11225208-11225230 GGAGAGGAGAACACTGTTGTTGG + Intronic
1186795026 X:13038940-13038962 GGAGAGGAGAACACTATTGTTGG - Intronic
1190518869 X:51255935-51255957 AATGAGGTGAACTCTACTATTGG - Intergenic
1196551835 X:117037555-117037577 GGTGAGGCAAACTCAAATGTAGG - Intergenic
1198795707 X:140391661-140391683 GGTGAAGAGAACTGTACCTTTGG - Intergenic
1199219832 X:145305475-145305497 GGTGAGGGGAACTGGAGTGTGGG + Intergenic
1200803687 Y:7410565-7410587 GGAGAGGAAATCTCTCCTGTTGG + Intergenic