ID: 1053072026

View in Genome Browser
Species Human (GRCh38)
Location 9:35107443-35107465
Sequence AACTGTTGGCAGCAGTAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053072022_1053072026 3 Left 1053072022 9:35107417-35107439 CCAGAAGGGTGTGGCTTTGGCAT 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG 0: 1
1: 1
2: 3
3: 18
4: 211
1053072016_1053072026 21 Left 1053072016 9:35107399-35107421 CCCAGGCAGCAGGTGGCTCCAGA 0: 2
1: 0
2: 5
3: 71
4: 415
Right 1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG 0: 1
1: 1
2: 3
3: 18
4: 211
1053072017_1053072026 20 Left 1053072017 9:35107400-35107422 CCAGGCAGCAGGTGGCTCCAGAA 0: 1
1: 1
2: 4
3: 46
4: 341
Right 1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG 0: 1
1: 1
2: 3
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053072026 Original CRISPR AACTGTTGGCAGCAGTAGGG TGG Exonic
900813674 1:4827158-4827180 AACCGTTCACAGCAGCAGGGTGG + Intergenic
900996430 1:6125693-6125715 AGCTGATGGCAGCAGGAGCGGGG - Intronic
901309220 1:8256268-8256290 GAATGTTGGCTGAAGTAGGGAGG + Intergenic
903082202 1:20819966-20819988 TACTATTGGCTGCAGCAGGGAGG + Intronic
903604721 1:24567293-24567315 AAGTGTTGTTATCAGTAGGGAGG - Intronic
903774408 1:25783508-25783530 AACTGTGGGCAGCAGGGTGGGGG - Intronic
904330764 1:29756490-29756512 AGCTGGTGGCGGCTGTAGGGAGG - Intergenic
905356168 1:37386416-37386438 TACTGGTGGCAGGACTAGGGAGG - Intergenic
905536406 1:38725673-38725695 AACTGGACACAGCAGTAGGGTGG + Intergenic
907195272 1:52681451-52681473 TACTGTGGGAAGCAGTAGGTTGG - Intergenic
907226223 1:52949540-52949562 AACTGGACACAGCAGTAGGGTGG - Intronic
907347510 1:53795033-53795055 AGCTGTTGGCTGGAGTAGTGGGG - Intronic
910864102 1:91771906-91771928 ATCTGTGGGCAGCAGGAAGGGGG + Intronic
911032540 1:93505369-93505391 AACTGGACACAGCAGTAGGGTGG - Intronic
911445893 1:97991190-97991212 AAGTGTTGGCATTAGTAGGCTGG - Intergenic
912438992 1:109684046-109684068 AACTGGACACAGCAGTAGGGTGG + Intronic
912441514 1:109702491-109702513 AACTGGACACAGCAGTAGGGTGG + Intronic
913260399 1:116992372-116992394 TACTGTTGGCACAAGTAGGTTGG - Intergenic
913429701 1:118777064-118777086 TACTGTAGGCAGCAGTAGGGAGG + Intergenic
914337563 1:146729559-146729581 AACAGTTGGCAGCAGGAGGATGG - Intergenic
915123464 1:153647433-153647455 AACTGTAGTGAGCAGTAGGTGGG - Intergenic
917253255 1:173086215-173086237 CACTGTTGGCAGGAGAATGGAGG + Intergenic
917406581 1:174713074-174713096 AAGTGCTGGGAGCAGAAGGGTGG - Intronic
918058686 1:181044397-181044419 AGGTGATGGCAGCAGCAGGGTGG + Intronic
918959977 1:191262062-191262084 AACTATTGGTAGCTGTTGGGTGG - Intergenic
920052619 1:203172832-203172854 AACAGGTGGCAGCAGTTGGTTGG + Intronic
922238661 1:223740412-223740434 AACTGGACACAGCAGTAGGGTGG - Intronic
922595605 1:226810512-226810534 AACTGGTGGCAGCAGCTTGGCGG + Intergenic
922721619 1:227902840-227902862 CACTGTGGGCACCAGTGGGGCGG + Intergenic
922976703 1:229790841-229790863 AACTGGACACAGCAGTAGGGTGG + Intergenic
923309196 1:232719211-232719233 AACTGGACACAGCAGTAGGGTGG - Intergenic
1064406806 10:15071216-15071238 AACTGTTGGCAGGAGGGAGGAGG - Intronic
1067354836 10:45514447-45514469 TGCTGCTGGCAGCTGTAGGGTGG - Intronic
1067708958 10:48633696-48633718 AAATGATGCCAGCAGCAGGGAGG + Intronic
1068023774 10:51617391-51617413 CACTGGTGGTAGCAGCAGGGTGG + Intronic
1069095146 10:64250068-64250090 TACTATTGGCACCAGTAGAGTGG - Intergenic
1069213622 10:65792372-65792394 AACTGGACACAGCAGTAGGGTGG - Intergenic
1069450826 10:68516246-68516268 AACTGGACACAGCAGTAGGGTGG - Intronic
1070016598 10:72539819-72539841 AAGTGTTGGCAGCAGTGCAGAGG + Intronic
1075308771 10:121393076-121393098 AACTGTTTGCAAAAGAAGGGGGG - Intergenic
1076758376 10:132587263-132587285 ACCTGCTGGCAGCAGGAGTGAGG + Intronic
1077714711 11:4569406-4569428 AACTGAGGGCAGCAGGAGGGCGG + Intergenic
1078730595 11:13970619-13970641 TAGTGTTGGCAGGAGTTGGGGGG - Intronic
1079110401 11:17602120-17602142 ACCCCTTGGCAGCAGTGGGGTGG - Intronic
1079112835 11:17614603-17614625 AATGGTTGTCAGCAGGAGGGGGG - Intronic
1079898112 11:26148375-26148397 AAAGGTGGCCAGCAGTAGGGGGG - Intergenic
1082749527 11:57001586-57001608 AAAGGTTGCCAGCAGTAGGGAGG - Intergenic
1084269201 11:68020083-68020105 GGCTGTGGGCACCAGTAGGGTGG - Intronic
1084477892 11:69399154-69399176 GAATGCTGGCAGCAGGAGGGAGG - Intergenic
1086286219 11:85254133-85254155 AATTGTTGGCAGAAGTGGGCAGG - Intronic
1090310419 11:125731855-125731877 AACTCTTGGCAGCATTTGGAGGG - Intergenic
1092629412 12:10362466-10362488 AACTGGATACAGCAGTAGGGTGG + Intergenic
1094477122 12:30849703-30849725 AACTGGACACAGCAGTAGGGTGG - Intergenic
1097062045 12:56292476-56292498 AACTGGACACAGCAGTAGGGTGG + Intronic
1098802881 12:74984828-74984850 AGCTGCTGGCTGCAGTGGGGTGG + Intergenic
1100773321 12:97948006-97948028 AGCTGAAGGCAGCAGTAGAGGGG + Intergenic
1102241945 12:111329968-111329990 CACTGTCGGCAGCAGGAGAGGGG - Intronic
1102478811 12:113206495-113206517 AACTGGACACAGCAGTAGGGTGG + Intronic
1102861514 12:116340330-116340352 AACTGGTGGCTGCAGATGGGAGG + Intergenic
1104066988 12:125314356-125314378 AACTCTAGGCAGCAGATGGGAGG + Intronic
1104843302 12:131834679-131834701 AGCTGCTGGCTGCAGTGGGGGGG + Intronic
1104952621 12:132448634-132448656 AACTTTTGGAAGCCGGAGGGAGG - Intergenic
1107611949 13:42123853-42123875 AACTGTTGGCAGCAGACCAGTGG + Intronic
1109736644 13:66494595-66494617 AATTGTTGGCAGTAGAATGGTGG - Intronic
1112415066 13:99197334-99197356 TACTGTGGGCAGGAGGAGGGGGG + Intergenic
1113523675 13:110957544-110957566 ATCTGTTGTCAGCAGGAGAGGGG + Intergenic
1115861081 14:37687124-37687146 ACCCGTTGGCAGCAGAGGGGTGG + Intronic
1118195203 14:63619063-63619085 AAGGCTTGGCAGAAGTAGGGAGG - Intronic
1118657728 14:67970227-67970249 AATTAATGGTAGCAGTAGGGTGG + Intronic
1119052971 14:71388811-71388833 AAATGTAGGTAGCACTAGGGAGG - Intronic
1121078329 14:91087728-91087750 AACTGGGCACAGCAGTAGGGTGG + Intronic
1121083159 14:91125109-91125131 AACTGGACACAGCAGTAGGGTGG + Intronic
1123540523 15:21285250-21285272 AACAGCTGGCAGCAGCAGGGAGG + Intergenic
1123838063 15:24216434-24216456 AACTGGACACAGCAGTAGGGTGG + Intergenic
1125004871 15:34806404-34806426 ACCTGTTGGCAGCTCTAGGTTGG - Intergenic
1127599056 15:60517050-60517072 AATTGTTGGCAGTAGTTGGTGGG + Intronic
1127950002 15:63795765-63795787 AACTGGACACAGCAGTAGGGTGG - Intronic
1128167475 15:65478825-65478847 AAATGTTGGAAGCAGAAGGTGGG - Intronic
1131273696 15:90962488-90962510 AACTGTTGCCCCCAGCAGGGTGG + Exonic
1202948837 15_KI270727v1_random:12392-12414 AACAGCTGGCAGCAGCAGGGAGG + Intergenic
1135878912 16:26233133-26233155 AATTTTTGGCAGCAGTGGGTGGG + Intergenic
1137027461 16:35492302-35492324 AACTGTTGGGAGGCGGAGGGTGG - Intergenic
1137039841 16:35600303-35600325 AACTGGACACAGCAGTAGGGTGG - Intergenic
1137043277 16:35633680-35633702 AAATGTTGGCAAGAGTATGGAGG - Intergenic
1139996718 16:70987769-70987791 AACAGTTGGCAGCAGGAGGATGG + Intronic
1140820685 16:78660200-78660222 AAATATTGTCAGCAGGAGGGAGG + Intronic
1142003235 16:87675975-87675997 AGCTGTTGGCAGGAGCTGGGAGG + Intronic
1142441311 16:90099688-90099710 AACTGGACACAGCAGTAGGGTGG + Intergenic
1143304973 17:5939329-5939351 TGCTGTTGGCAGAAGAAGGGAGG - Intronic
1143923325 17:10348305-10348327 AACTGCTGGAAGCAGTGGAGAGG - Intronic
1144238002 17:13281283-13281305 AATAGTTGGTTGCAGTAGGGTGG - Intergenic
1144877391 17:18407270-18407292 AACTGTTGGTACCTGTGGGGAGG - Intergenic
1145154837 17:20537133-20537155 AACTGTTGGTACCTGTGGGGAGG + Intergenic
1145933545 17:28702173-28702195 AAGCGGTGGCAGCAGCAGGGGGG - Exonic
1146031393 17:29369141-29369163 TACTGTTGGCTGGAGTAGAGCGG - Intergenic
1146885504 17:36467969-36467991 CACCGCTGGCAGCAATAGGGTGG + Intergenic
1147467039 17:40618219-40618241 AACCTCTGGCAGCAGTAGGGTGG + Intergenic
1147953785 17:44121438-44121460 TCCTGTTGGTGGCAGTAGGGGGG - Intronic
1148245452 17:46027115-46027137 AACTGTTGGCAGTAATGAGGGGG - Exonic
1150518375 17:65838175-65838197 AAATGTCTGCAGCAGTTGGGTGG - Intronic
1150846997 17:68669207-68669229 AATTGTTGGGAGAAGGAGGGAGG + Intergenic
1154157900 18:11958452-11958474 AACTGATATCAGGAGTAGGGCGG + Intergenic
1159174293 18:64813943-64813965 CACTGTTGGCAGGAGTAGGGCGG - Intergenic
1159644296 18:70899043-70899065 AACTGGAGGCTGCAGGAGGGAGG + Intergenic
1162265960 19:9574562-9574584 AACTGGACACAGCAGTAGGGTGG - Intronic
1163210685 19:15837513-15837535 AACTGGACACAGCAGTAGGGTGG - Intergenic
1163692935 19:18746916-18746938 AACAGCTGGGACCAGTAGGGCGG - Intronic
1163976478 19:20857948-20857970 AACTGGACACAGCAGTAGGGTGG + Intronic
1165294739 19:34917431-34917453 AACTGGACACAGCAGTAGGGTGG - Intergenic
928924322 2:36561941-36561963 ACCTCTTGGCAGGAGTTGGGTGG - Intronic
928980072 2:37128216-37128238 ACCTGTTTGCATCAGTGGGGCGG - Intronic
931561696 2:63568616-63568638 AACTGGACACAGCAGTAGGGTGG - Intronic
931581365 2:63778952-63778974 AAATCTAGGCAGCAGAAGGGAGG - Intronic
936175412 2:110215676-110215698 ACCTGTTGGAAGCAGTAGAGTGG - Intergenic
937726594 2:125174531-125174553 AACTGGACACAGCAGTAGGGTGG + Intergenic
937978496 2:127596582-127596604 CACTGTGGGCAGGAGTAGGCTGG - Intronic
938865872 2:135419517-135419539 AACTGTATGCATCTGTAGGGAGG + Intronic
939505132 2:143036322-143036344 AACTGGACACAGCAGTAGGGTGG - Intronic
942041146 2:172064169-172064191 AACTACAGGCAGGAGTAGGGGGG - Intronic
942354965 2:175100849-175100871 AACTGGACACAGCAGTAGGGTGG + Intronic
943100664 2:183482056-183482078 TCCTGTTGGCGGCAGTGGGGTGG + Intergenic
943819231 2:192298882-192298904 CACTGGTGGCAGAAGTGGGGAGG - Intergenic
1169953251 20:11072112-11072134 AACTGTTGTAAGCATTAGAGTGG - Intergenic
1170976882 20:21173221-21173243 CTGTGGTGGCAGCAGTAGGGTGG + Intronic
1172043757 20:32064437-32064459 AACTGTTGTTAGAAGAAGGGGGG + Intronic
1173139840 20:40472174-40472196 ATCTGATGGCGGCAGGAGGGAGG - Intergenic
1173587843 20:44197567-44197589 ACCTGATGGCAGCAGTGGGCTGG - Exonic
1173980214 20:47218221-47218243 GTCTGTTGGCATCAGGAGGGTGG - Intronic
1174290402 20:49504361-49504383 CACTATTGGCAGCAATTGGGGGG + Exonic
1177812491 21:25939199-25939221 AGCTGTTGGCAGCAGGATGAAGG + Intronic
1178111056 21:29370534-29370556 TTCTGTTGCCATCAGTAGGGGGG + Intronic
1181793676 22:25287515-25287537 GACTGGGGGCAGCAGTAGGGAGG + Intergenic
1182715596 22:32354290-32354312 CACTGTTGGCAGCAGGGAGGGGG - Intergenic
1184513338 22:44945701-44945723 TACTGTTGGCAGAATTGGGGGGG + Intronic
949960775 3:9310327-9310349 TACTGTTGGCAGGAGAAGAGAGG - Intronic
953735561 3:45491444-45491466 GACTGGTGGCAGCATCAGGGTGG + Intronic
954129146 3:48550933-48550955 AACTGTGGGCAGGATCAGGGAGG + Intronic
955130784 3:56165553-56165575 AACAGCTGTCAGCAGTAGGGTGG - Intronic
955226556 3:57065043-57065065 AACTGTAGGGAGAAGTAGGGTGG + Intronic
955581345 3:60426410-60426432 GAATGTTTGTAGCAGTAGGGAGG - Intronic
959848158 3:111057372-111057394 AACTGTTGGCCTCTGTTGGGAGG - Intergenic
960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG + Intergenic
960830264 3:121839273-121839295 TTCTCTTGGCAGCAGTTGGGTGG + Intronic
966226056 3:177599264-177599286 AACTGGTGGAAGCAGAGGGGAGG + Intergenic
966610210 3:181860548-181860570 AACTATTGACTGCAGAAGGGTGG + Intergenic
966888159 3:184388006-184388028 CACTGTTTGCAGCAGTCGGTGGG - Exonic
968160215 3:196420586-196420608 TATTGTAGGCAGCAGCAGGGTGG + Intronic
968361568 3:198150664-198150686 AACTGGACACAGCAGTAGGGTGG + Intergenic
970176294 4:13342724-13342746 ATGTGTTCGCATCAGTAGGGTGG + Intergenic
972689457 4:41382463-41382485 TACTGTAGGCAGCAGTAGGGAGG + Intronic
977988342 4:103412642-103412664 AACTGGACACAGCAGTAGGGTGG - Intergenic
979888781 4:126064047-126064069 AACTGGACACAGCAGTAGGGTGG - Intergenic
980523280 4:133958513-133958535 AACTGATGCCAGGAGTAGTGGGG - Intergenic
980897261 4:138871927-138871949 GCCTGTTGGCAGGTGTAGGGTGG - Intergenic
981033320 4:140147498-140147520 AAAGGTTGGCAGCAGGTGGGGGG + Intronic
982588291 4:157271327-157271349 ATCTGAAGGCAGCAGCAGGGAGG - Intronic
984260762 4:177441966-177441988 AACTATGGTCAGCAGCAGGGTGG + Intronic
984874666 4:184356610-184356632 ATCTGTTGGCAGCAGTGCTGGGG - Intergenic
988797505 5:34665823-34665845 AACTGTGGGTGGCAGTGGGGTGG - Intronic
995106321 5:108381261-108381283 AACTCTTTGCAGCAGGAGGCGGG + Exonic
996683818 5:126257676-126257698 CAGTGCTGGCAGCAGTAGGCTGG - Intergenic
996713486 5:126567232-126567254 AACTGGACACAGCAGTAGGGTGG + Intronic
999580514 5:153033360-153033382 AACCGGTCGCAGCAGTAGGGTGG - Intergenic
999833855 5:155347977-155347999 AACTGGACACAGCAGTAGGGTGG + Intergenic
1000327952 5:160186563-160186585 AACTGGACACAGCAGTAGGGTGG + Intergenic
1001684613 5:173584141-173584163 AAGTGTTAGCTGGAGTAGGGGGG + Intergenic
1002061033 5:176626281-176626303 AGCTGGTGGCAGGATTAGGGGGG + Intronic
1002204747 5:177554582-177554604 ACCTGTTGGCAGCAGGCGGAGGG - Intergenic
1002546237 5:179947282-179947304 TACTGTGGGCAGCAGTCAGGAGG - Intronic
1002926119 6:1606619-1606641 AACTGTGGGCTGCAGTGGGGAGG - Intergenic
1005510020 6:26504382-26504404 AAATGTTTGCAGCAGTTTGGTGG - Intronic
1005909251 6:30293876-30293898 AACTGGAGGCAGCTGTAGTGAGG + Intergenic
1006002527 6:30976486-30976508 AACTGTTGGCTACAGGATGGGGG - Intergenic
1006582770 6:35086331-35086353 AACAGATGGCAGCGGTAGGTAGG - Intronic
1008276772 6:49551371-49551393 CACTTTTCGCAGCAGTAGAGAGG + Exonic
1010454468 6:76039022-76039044 AACAGCTGGCAGCAGAACGGGGG - Intronic
1010691045 6:78911084-78911106 AGCTGCTGGCAGCAGAAGGAAGG - Intronic
1012113219 6:95261924-95261946 AAATGTTGTCAGTAGTATGGGGG - Intergenic
1016125371 6:140395763-140395785 AACAGTGAGCAGCAGGAGGGAGG - Intergenic
1017824486 6:158071406-158071428 AGCGGTGGGCAGCAGGAGGGAGG + Intronic
1018065115 6:160119111-160119133 AAATGATGGCAGCAGCAGGGAGG - Intergenic
1018433043 6:163737848-163737870 AACTGTGGGCAGCAGGTGGGGGG + Intergenic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1019254117 7:38056-38078 AACTGGACACAGCAGTAGGGTGG - Intergenic
1022570080 7:31444097-31444119 AACTCTTGAAAGCAGTAGGATGG - Intergenic
1023847208 7:44129082-44129104 GTGTGTTGGCAGCAGGAGGGAGG + Intergenic
1026164026 7:67894210-67894232 AACAGTAGGTAGCAGTAGGGAGG - Intergenic
1027489910 7:78810231-78810253 AACTGTTGGCAGCATTTCTGAGG + Intronic
1028843323 7:95452177-95452199 AAATGTTGACAACAGCAGGGAGG - Intergenic
1028905366 7:96148307-96148329 AGCTGTTCTGAGCAGTAGGGCGG - Intronic
1028935844 7:96463200-96463222 GAATGATGGCGGCAGTAGGGCGG - Intergenic
1030204003 7:106934819-106934841 TATTGTTTGTAGCAGTAGGGGGG - Intergenic
1030207836 7:106967815-106967837 AACTGGACACAGCAGTAGGGTGG + Intergenic
1032073468 7:128824446-128824468 AACTGGTGGCGGCAGTAAAGTGG - Intergenic
1033544944 7:142391454-142391476 GCCTGCTGGCATCAGTAGGGTGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035472225 7:159117742-159117764 CACTGATGACAGCAGCAGGGTGG - Intronic
1037377759 8:18250498-18250520 AACTGATGGCAGCACAATGGTGG + Intergenic
1038525087 8:28266198-28266220 AACTGGACACAGCAGTAGGGCGG - Intergenic
1039699513 8:39947628-39947650 AACTGGACACAGCAGTAGGGTGG + Intronic
1039961743 8:42253810-42253832 AACTGGGCACAGCAGTAGGGTGG - Intergenic
1040926896 8:52694190-52694212 TGCAGTTGCCAGCAGTAGGGTGG - Intronic
1044298070 8:90551482-90551504 ATCTCATGCCAGCAGTAGGGTGG - Intergenic
1044519350 8:93179684-93179706 ATCTTTTGGGAGCACTAGGGAGG - Intergenic
1044947355 8:97401996-97402018 AACTATTGGTAGCTGTTGGGTGG - Intergenic
1045808043 8:106188684-106188706 AGCAGATGGCAGTAGTAGGGTGG - Intergenic
1047095501 8:121620705-121620727 AACTCTTGGCTGGAGTAGTGAGG - Intronic
1047670595 8:127142070-127142092 AACTGTTGGGTGTAGTAGGGTGG + Intergenic
1048173407 8:132129776-132129798 ACCTGGTGGAAGCTGTAGGGTGG + Exonic
1050334689 9:4579284-4579306 AACTGTTGGAAGCACAGGGGTGG - Intronic
1051342862 9:16127850-16127872 AGCTGTGGGCAGGAGTAGGGTGG + Intergenic
1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG + Exonic
1056974261 9:91236243-91236265 AACTGGTGGCAGGGGTTGGGGGG + Intronic
1057181312 9:93032267-93032289 CTCTGTGGGAAGCAGTAGGGTGG - Intronic
1057615117 9:96582536-96582558 AACTGGACACAGCAGTAGGGTGG + Intronic
1060367640 9:123034510-123034532 AACTGTTGGCAGCAGCCAAGCGG + Exonic
1061470096 9:130817549-130817571 AACTGGACACAGCAGTAGGGTGG + Intronic
1061497059 9:130981227-130981249 AACTGTGGGCAGTGGTCGGGAGG - Intergenic
1062746286 9:138214485-138214507 AACTGGACACAGCAGTAGGGTGG + Intergenic
1203454354 Un_GL000219v1:151070-151092 AACTGGTGGCAGAAATAAGGAGG - Intergenic
1185703805 X:2251553-2251575 AACTGGACACAGCAGTAGGGCGG + Intronic
1187077287 X:15947779-15947801 AAGTGTAGCCAGCAGCAGGGTGG + Intergenic
1188157477 X:26757227-26757249 AACTGGACACAGCAGTAGGGTGG + Intergenic
1189964628 X:46359940-46359962 AACTGGACACAGCAGTAGGGTGG - Intergenic
1191033109 X:55996833-55996855 ATCTGTTGGCAGCAGTGGCATGG + Intergenic
1191671219 X:63750655-63750677 AACTTTTGGCTGCATCAGGGAGG - Intronic
1191846953 X:65554012-65554034 AACTGGACACAGCAGTAGGGTGG + Intergenic
1192573975 X:72228143-72228165 AACTGGACACAGCAGTAGGGTGG + Intronic
1193797717 X:85897362-85897384 AAATGTTGCCAGCAGCAGTGGGG + Intronic
1194858600 X:98965774-98965796 AATTGTTGGCATCATTATGGAGG + Intergenic
1198950664 X:142067643-142067665 CACTGATGGCAGCAGTAAGCAGG - Intergenic
1199151704 X:144494673-144494695 AACTGGACACAGCAGTAGGGCGG - Intergenic
1199221904 X:145326388-145326410 AACTGGATACAGCAGTAGGGTGG - Intergenic
1201668959 Y:16493489-16493511 AACTGGACACAGCAGTAGGGTGG + Intergenic