ID: 1053079057

View in Genome Browser
Species Human (GRCh38)
Location 9:35159573-35159595
Sequence TCAAGATTAGCCGGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053079057_1053079068 25 Left 1053079057 9:35159573-35159595 CCACCAGGCCCGGCTAATCTTGA No data
Right 1053079068 9:35159621-35159643 GCCTCAGCCTCCCAAAGTGCTGG No data
1053079057_1053079070 26 Left 1053079057 9:35159573-35159595 CCACCAGGCCCGGCTAATCTTGA No data
Right 1053079070 9:35159622-35159644 CCTCAGCCTCCCAAAGTGCTGGG No data
1053079057_1053079064 -5 Left 1053079057 9:35159573-35159595 CCACCAGGCCCGGCTAATCTTGA No data
Right 1053079064 9:35159591-35159613 CTTGAACTTGTGGGGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053079057 Original CRISPR TCAAGATTAGCCGGGCCTGG TGG (reversed) Intergenic