ID: 1053079057 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:35159573-35159595 |
| Sequence | TCAAGATTAGCCGGGCCTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053079057_1053079068 | 25 | Left | 1053079057 | 9:35159573-35159595 | CCACCAGGCCCGGCTAATCTTGA | No data | ||
| Right | 1053079068 | 9:35159621-35159643 | GCCTCAGCCTCCCAAAGTGCTGG | 0: 56931 1: 168651 2: 218048 3: 269456 4: 306914 |
||||
| 1053079057_1053079070 | 26 | Left | 1053079057 | 9:35159573-35159595 | CCACCAGGCCCGGCTAATCTTGA | No data | ||
| Right | 1053079070 | 9:35159622-35159644 | CCTCAGCCTCCCAAAGTGCTGGG | 0: 90349 1: 212695 2: 235979 3: 260133 4: 296590 |
||||
| 1053079057_1053079064 | -5 | Left | 1053079057 | 9:35159573-35159595 | CCACCAGGCCCGGCTAATCTTGA | No data | ||
| Right | 1053079064 | 9:35159591-35159613 | CTTGAACTTGTGGGGTCAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053079057 | Original CRISPR | TCAAGATTAGCCGGGCCTGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||