ID: 1053079058

View in Genome Browser
Species Human (GRCh38)
Location 9:35159576-35159598
Sequence AGTTCAAGATTAGCCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053079058_1053079068 22 Left 1053079058 9:35159576-35159598 CCAGGCCCGGCTAATCTTGAACT No data
Right 1053079068 9:35159621-35159643 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1053079058_1053079070 23 Left 1053079058 9:35159576-35159598 CCAGGCCCGGCTAATCTTGAACT No data
Right 1053079070 9:35159622-35159644 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1053079058_1053079064 -8 Left 1053079058 9:35159576-35159598 CCAGGCCCGGCTAATCTTGAACT No data
Right 1053079064 9:35159591-35159613 CTTGAACTTGTGGGGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053079058 Original CRISPR AGTTCAAGATTAGCCGGGCC TGG (reversed) Intergenic
No off target data available for this crispr