ID: 1053079061

View in Genome Browser
Species Human (GRCh38)
Location 9:35159582-35159604
Sequence CCCACAAGTTCAAGATTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053079061_1053079068 16 Left 1053079061 9:35159582-35159604 CCGGCTAATCTTGAACTTGTGGG No data
Right 1053079068 9:35159621-35159643 GCCTCAGCCTCCCAAAGTGCTGG 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
1053079061_1053079070 17 Left 1053079061 9:35159582-35159604 CCGGCTAATCTTGAACTTGTGGG No data
Right 1053079070 9:35159622-35159644 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1053079061_1053079072 25 Left 1053079061 9:35159582-35159604 CCGGCTAATCTTGAACTTGTGGG No data
Right 1053079072 9:35159630-35159652 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053079061 Original CRISPR CCCACAAGTTCAAGATTAGC CGG (reversed) Intergenic
No off target data available for this crispr