ID: 1053079064

View in Genome Browser
Species Human (GRCh38)
Location 9:35159591-35159613
Sequence CTTGAACTTGTGGGGTCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053079057_1053079064 -5 Left 1053079057 9:35159573-35159595 CCACCAGGCCCGGCTAATCTTGA No data
Right 1053079064 9:35159591-35159613 CTTGAACTTGTGGGGTCAAGTGG No data
1053079053_1053079064 25 Left 1053079053 9:35159543-35159565 CCTTCGAATAGCTGGGATTACAG 0: 4
1: 147
2: 1853
3: 6900
4: 15872
Right 1053079064 9:35159591-35159613 CTTGAACTTGTGGGGTCAAGTGG No data
1053079058_1053079064 -8 Left 1053079058 9:35159576-35159598 CCAGGCCCGGCTAATCTTGAACT No data
Right 1053079064 9:35159591-35159613 CTTGAACTTGTGGGGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053079064 Original CRISPR CTTGAACTTGTGGGGTCAAG TGG Intergenic
No off target data available for this crispr