ID: 1053079070

View in Genome Browser
Species Human (GRCh38)
Location 9:35159622-35159644
Sequence CCTCAGCCTCCCAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1095746
Summary {0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053079058_1053079070 23 Left 1053079058 9:35159576-35159598 CCAGGCCCGGCTAATCTTGAACT No data
Right 1053079070 9:35159622-35159644 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1053079059_1053079070 18 Left 1053079059 9:35159581-35159603 CCCGGCTAATCTTGAACTTGTGG No data
Right 1053079070 9:35159622-35159644 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1053079061_1053079070 17 Left 1053079061 9:35159582-35159604 CCGGCTAATCTTGAACTTGTGGG No data
Right 1053079070 9:35159622-35159644 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
1053079057_1053079070 26 Left 1053079057 9:35159573-35159595 CCACCAGGCCCGGCTAATCTTGA No data
Right 1053079070 9:35159622-35159644 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053079070 Original CRISPR CCTCAGCCTCCCAAAGTGCT GGG Intergenic
Too many off-targets to display for this crispr