ID: 1053086261

View in Genome Browser
Species Human (GRCh38)
Location 9:35225676-35225698
Sequence GTGGTGTAGGCTATAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053086257_1053086261 8 Left 1053086257 9:35225645-35225667 CCTTTACTCGGACTAGTTTCTTG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1053086261 9:35225676-35225698 GTGGTGTAGGCTATAATTGTTGG No data
1053086255_1053086261 24 Left 1053086255 9:35225629-35225651 CCGTATGATTTCTTCACCTTTAC 0: 1
1: 0
2: 2
3: 36
4: 317
Right 1053086261 9:35225676-35225698 GTGGTGTAGGCTATAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053086261 Original CRISPR GTGGTGTAGGCTATAATTGT TGG Intronic
No off target data available for this crispr