ID: 1053089800

View in Genome Browser
Species Human (GRCh38)
Location 9:35264695-35264717
Sequence ATTTACTTCATTATGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053089797_1053089800 -1 Left 1053089797 9:35264673-35264695 CCACAGACCTGGGGGCAAGGTCA 0: 1
1: 0
2: 1
3: 15
4: 234
Right 1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG No data
1053089791_1053089800 7 Left 1053089791 9:35264665-35264687 CCCCCTCACCACAGACCTGGGGG 0: 1
1: 0
2: 4
3: 53
4: 490
Right 1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG No data
1053089795_1053089800 4 Left 1053089795 9:35264668-35264690 CCTCACCACAGACCTGGGGGCAA 0: 1
1: 0
2: 3
3: 38
4: 298
Right 1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG No data
1053089794_1053089800 5 Left 1053089794 9:35264667-35264689 CCCTCACCACAGACCTGGGGGCA 0: 1
1: 0
2: 1
3: 32
4: 254
Right 1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG No data
1053089789_1053089800 8 Left 1053089789 9:35264664-35264686 CCCCCCTCACCACAGACCTGGGG 0: 1
1: 0
2: 9
3: 66
4: 613
Right 1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG No data
1053089798_1053089800 -8 Left 1053089798 9:35264680-35264702 CCTGGGGGCAAGGTCATTTACTT 0: 1
1: 0
2: 1
3: 10
4: 102
Right 1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG No data
1053089793_1053089800 6 Left 1053089793 9:35264666-35264688 CCCCTCACCACAGACCTGGGGGC 0: 1
1: 1
2: 12
3: 163
4: 946
Right 1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053089800 Original CRISPR ATTTACTTCATTATGTAAGA GGG Intronic
No off target data available for this crispr