ID: 1053090144

View in Genome Browser
Species Human (GRCh38)
Location 9:35267854-35267876
Sequence TCAAGAAGCCTCTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053090144_1053090149 2 Left 1053090144 9:35267854-35267876 CCTGTTACTTAGAGGCTTCTTGA No data
Right 1053090149 9:35267879-35267901 GGGGAAATATCAAGATAACTGGG No data
1053090144_1053090148 1 Left 1053090144 9:35267854-35267876 CCTGTTACTTAGAGGCTTCTTGA No data
Right 1053090148 9:35267878-35267900 TGGGGAAATATCAAGATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053090144 Original CRISPR TCAAGAAGCCTCTAAGTAAC AGG (reversed) Intronic