ID: 1053090144 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:35267854-35267876 |
| Sequence | TCAAGAAGCCTCTAAGTAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053090144_1053090148 | 1 | Left | 1053090144 | 9:35267854-35267876 | CCTGTTACTTAGAGGCTTCTTGA | No data | ||
| Right | 1053090148 | 9:35267878-35267900 | TGGGGAAATATCAAGATAACTGG | No data | ||||
| 1053090144_1053090149 | 2 | Left | 1053090144 | 9:35267854-35267876 | CCTGTTACTTAGAGGCTTCTTGA | No data | ||
| Right | 1053090149 | 9:35267879-35267901 | GGGGAAATATCAAGATAACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053090144 | Original CRISPR | TCAAGAAGCCTCTAAGTAAC AGG (reversed) | Intronic | ||