ID: 1053090149

View in Genome Browser
Species Human (GRCh38)
Location 9:35267879-35267901
Sequence GGGGAAATATCAAGATAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053090144_1053090149 2 Left 1053090144 9:35267854-35267876 CCTGTTACTTAGAGGCTTCTTGA No data
Right 1053090149 9:35267879-35267901 GGGGAAATATCAAGATAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053090149 Original CRISPR GGGGAAATATCAAGATAACT GGG Intronic