ID: 1053096552

View in Genome Browser
Species Human (GRCh38)
Location 9:35333545-35333567
Sequence GATGAAAGGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2793
Summary {0: 1, 1: 0, 2: 38, 3: 296, 4: 2458}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053096552 Original CRISPR GATGAAAGGGAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr