ID: 1053102203

View in Genome Browser
Species Human (GRCh38)
Location 9:35380575-35380597
Sequence CCTTGGCCAAACCATCATTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053102200_1053102203 1 Left 1053102200 9:35380551-35380573 CCTAAAGCGAGAGTCTGATGATT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1053102203 9:35380575-35380597 CCTTGGCCAAACCATCATTGAGG 0: 1
1: 0
2: 1
3: 19
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053102203 Original CRISPR CCTTGGCCAAACCATCATTG AGG Exonic
900039706 1:448439-448461 CTTTGACCAAACCAACATTGTGG - Intergenic
900061138 1:683415-683437 CTTTGACCAAACCAACATTGTGG - Intergenic
902558699 1:17262218-17262240 CCTTGGCCACACCATCAACATGG - Intronic
904055520 1:27667656-27667678 ATTTGGCCAAAGCATCAGTGAGG + Intronic
904657590 1:32060826-32060848 ACTTGACCAAACCTTTATTGAGG - Intronic
906371005 1:45253823-45253845 CATTGGCCAAACCATCCTGAGGG - Intronic
910136718 1:83980532-83980554 ATCTGGCCAAACCATCATTCAGG + Intronic
915090390 1:153419990-153420012 CATTGAGCAAACCATCATTTAGG - Exonic
915943331 1:160132890-160132912 CCTGTGCCAAACCAACATTTAGG + Intronic
918190982 1:182174361-182174383 GATTGGCCAAACAATCATTCAGG - Intergenic
922042818 1:221913800-221913822 CCTGGTACAAACCATCATGGGGG - Intergenic
923091101 1:230741843-230741865 CCTAGGCCAAAACATCATTGTGG + Intergenic
1068364146 10:56022912-56022934 CCATGGCCAAACAATTAGTGAGG - Intergenic
1070283743 10:75069185-75069207 CCTCTGCCAAACCAAGATTGGGG - Intergenic
1070325243 10:75384657-75384679 CCATGGCCAGAGCATCATTTGGG - Intergenic
1071217208 10:83420808-83420830 CTTTGGCAAAAACATCATTAAGG + Intergenic
1072186132 10:93040884-93040906 CCTTGGGGAAACCAACATTTAGG - Intronic
1072797111 10:98364585-98364607 CACTGGCCAAAGCATCAGTGTGG + Intergenic
1073875948 10:107921195-107921217 CCTTGGCCACACCACTACTGAGG + Intergenic
1075065345 10:119285552-119285574 CATTGGCCAAACAAGCCTTGGGG + Intronic
1076965929 11:84352-84374 CTTTGACCAAACCAACATTGTGG - Intergenic
1080220741 11:29900631-29900653 GCCTGGCCAATCCATCACTGAGG - Intergenic
1084440462 11:69169877-69169899 GCTGGGCCAGGCCATCATTGTGG - Intergenic
1088388608 11:109288842-109288864 AATTGGCCTAACCATCATTCAGG - Intergenic
1090917294 11:131176899-131176921 CCTTGGCCAAACCTTCATGTGGG - Intergenic
1090951463 11:131477050-131477072 TCTGGGTCAAACCATCACTGAGG - Intronic
1091095733 11:132820566-132820588 CCTTGGCCTTACCCTCATTCAGG + Intronic
1092153129 12:6264819-6264841 CCTGGGCCAAACCACCACTGGGG + Intergenic
1096854900 12:54473770-54473792 CCTTGGGCACCCCATCTTTGGGG + Intergenic
1098865811 12:75762002-75762024 CCTGGCCCATGCCATCATTGAGG - Intergenic
1109717847 13:66240019-66240041 CCTTGGCCACACCACCATACAGG + Intergenic
1118965492 14:70579886-70579908 CCTTGGCCAATCCATGAGTGTGG - Intergenic
1121200007 14:92108866-92108888 CCTTCCCCAATCCCTCATTGTGG - Intergenic
1127196586 15:56592128-56592150 TCTTGTCCAAACCATCAAGGTGG + Intergenic
1130153240 15:81327622-81327644 CTTTGGTCAAACTATTATTGAGG - Intergenic
1132442202 15:101879173-101879195 CTTTGACCAAACCAACATTGTGG + Intergenic
1136182308 16:28562081-28562103 CTTTGGCCAGGCCATCATCGTGG + Intronic
1138530147 16:57630404-57630426 CCTTGGTCACAGCATCACTGTGG + Intronic
1142271138 16:89089899-89089921 CCCTGGCACAAACATCATTGAGG + Intronic
1143352529 17:6299167-6299189 CCATGGCCACATCCTCATTGTGG + Intergenic
1143527785 17:7482482-7482504 CCTAGGACTAATCATCATTGTGG + Exonic
1144727576 17:17509587-17509609 CCCTGGCCACACCATCACTGAGG + Intronic
1146730976 17:35193788-35193810 CCTAGGACTAATCATCATTGTGG - Exonic
1157177066 18:45461260-45461282 CATTGGGGAAAGCATCATTGTGG + Intronic
1158854930 18:61533688-61533710 CATTGCCCAGACCAACATTGTGG + Intronic
1160642733 19:153982-154004 CTTTGACCAAACCAACATTGTGG - Intergenic
1163495747 19:17645716-17645738 CCTGGGGCAGACGATCATTGAGG - Exonic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
932368873 2:71171406-71171428 CCTTTGCAGAATCATCATTGTGG - Intergenic
936275261 2:111090652-111090674 CCTGGGGAAAACCATCATTTGGG + Intronic
944937727 2:204586689-204586711 TCTCTGCCAAACCATCCTTGTGG - Intronic
944951914 2:204761159-204761181 CCTTGGCCATACAATGATTGTGG - Intronic
946765655 2:223037638-223037660 CCTTTGCAAAACTATAATTGAGG - Intergenic
1174625557 20:51911724-51911746 CCATGGCCAAACCACCCCTGGGG - Intergenic
1177633654 21:23758286-23758308 CCTCGGGGAACCCATCATTGTGG - Intergenic
1178700769 21:34832234-34832256 CCTGGGCAAAAGCATTATTGTGG - Intronic
1179001062 21:37458615-37458637 CCTTGGCCCCAGCATCAGTGTGG - Intronic
1181622871 22:24102878-24102900 CCTGTGCCAAACCCCCATTGTGG + Intronic
1182525735 22:30917584-30917606 CCTAAGTCAAACCATCATTAAGG + Intergenic
1184848353 22:47102848-47102870 CCTTGGAGAACCCATCATTCTGG + Intronic
956139663 3:66132886-66132908 CATTGACCAAAACATCATTATGG + Intergenic
957163957 3:76646743-76646765 CCTTAGACAAACCATCATTATGG - Intronic
963123427 3:141794796-141794818 CCGTATCCAAACCATCACTGAGG - Intronic
965074791 3:163962739-163962761 CATTGACCCAATCATCATTGAGG - Intergenic
969100172 4:4762774-4762796 CCTGGGCCAAAGAAGCATTGGGG - Intergenic
970046569 4:11861276-11861298 TTTTGGCCAAAAAATCATTGTGG - Intergenic
974064420 4:57064674-57064696 CATTGGCTATACCATCATTTAGG - Intronic
978058647 4:104308043-104308065 TCTTTGCCTACCCATCATTGTGG - Intergenic
979099659 4:116599102-116599124 CATTGCCCCAACCATCATCGAGG + Intergenic
980045764 4:127986725-127986747 ACTTGTCCAAGCCATCATAGTGG + Intronic
980970570 4:139563379-139563401 CCTTTGCCACACCATCTTGGGGG - Intronic
983861422 4:172711869-172711891 CCTTGGCCAATCCATCCAAGAGG + Intronic
988207821 5:28163094-28163116 CTTTGTCCAAACCACCATTGTGG - Intergenic
989448347 5:41557331-41557353 CCTTGTCCAGACTAACATTGTGG + Intergenic
995740273 5:115348686-115348708 CCTTGACCAAACTATTGTTGTGG - Intergenic
998139977 5:139694249-139694271 CCTTGGCCAAATGAACAGTGTGG - Intergenic
1001848168 5:174939930-174939952 CATTGGGCAATCTATCATTGAGG + Intergenic
1002734141 5:181370504-181370526 CTTTGACCAAACCAACATTGTGG + Intergenic
1002750400 6:103622-103644 CTTTGACCAAACCAACATTGTGG - Intergenic
1003591193 6:7438217-7438239 CCTTGGCCAGGCCTTTATTGTGG - Intergenic
1014741184 6:125149262-125149284 CTTTGGCTAAACCATTATTAGGG + Intronic
1014981997 6:127955684-127955706 CCTTGGCCAAACCAACTCTAAGG + Intergenic
1019238389 6:170642818-170642840 CTTTGACCAAACCAACATTGTGG + Intergenic
1021329893 7:19323599-19323621 CCTTGGCCTAAACATCTGTGAGG + Intergenic
1021485301 7:21161238-21161260 CCACGGCCAATCCATCATTCTGG - Intergenic
1021522704 7:21553270-21553292 CCTGGGTCAAAACATGATTGTGG - Intronic
1022879145 7:34567616-34567638 CCTTGTGCAAAACATCCTTGTGG - Intergenic
1023808053 7:43888901-43888923 CCTTGCCCCAGCCATCATTCAGG - Intronic
1024015340 7:45308755-45308777 CCTTGACCCAATCATCATTCAGG + Intergenic
1027229641 7:76264726-76264748 CCCGGGCCACACCATCACTGTGG + Intronic
1027994122 7:85402217-85402239 CCTTTGACATTCCATCATTGTGG + Intergenic
1033598846 7:142874923-142874945 CTTTGGACAGACCATCCTTGGGG - Exonic
1035509380 8:163789-163811 CTTTGACCAAACCAACATTGTGG - Intergenic
1040695957 8:49999094-49999116 CTTTAACCGAACCATCATTGTGG + Intronic
1044733879 8:95257550-95257572 CATTGACCAAAACATCACTGGGG - Intronic
1053102203 9:35380575-35380597 CCTTGGCCAAACCATCATTGAGG + Exonic
1055132624 9:72793415-72793437 ACTTGGCCATTCCATCATTCAGG + Intronic
1060964968 9:127707252-127707274 CCATGGCCAAACCTGCATGGGGG - Intronic
1061096385 9:128459229-128459251 CCTTGGCCAAACCAGCACATTGG + Intronic
1062758593 9:138323110-138323132 CTTTGACCAAACCAACATTGTGG + Intergenic
1203486274 Un_GL000224v1:58391-58413 CCTTGGACAAACAATAATTGAGG - Intergenic
1203498895 Un_KI270741v1:289-311 CCTTGGACAAACAATAATTGAGG - Intergenic
1192046685 X:67682732-67682754 CCTTGGCTCTACCATCATTTGGG + Intronic
1195996011 X:110732356-110732378 CCTTGGCCCAACCCCCAGTGAGG + Intronic